Overview

Distribution

depth in m: 0-500; horizontal distribution: Atlantic 40°N°-40°S, Pacific 30°-40°N, SE Pacific 10°N-40°S
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Mesopelagic
  • Census of Marine Zooplankton, 2007. Polarstern Cruise ANT-24-1. Identifications by J. Bradford-Grieve, L. Blanco Bercial, R. Escribano, M. Kuriyama, Y. Nishibe, N. Copley & P. Wiebe.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Epipelagic
  • Census of Marine Zooplankton, 2007. Polarstern Cruise ANT-24-1. Identifications by J. Bradford-Grieve, L. Blanco Bercial, R. Escribano, M. Kuriyama, Y. Nishibe, N. Copley & P. Wiebe.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 86 specimens in 1 taxon.
Water temperature and chemistry ranges based on 84 samples.

Environmental ranges
  Depth range (m): 5 - 2505
  Temperature range (°C): 3.229 - 23.913
  Nitrate (umol/L): 0.229 - 42.002
  Salinity (PPS): 34.406 - 36.595
  Oxygen (ml/l): 1.298 - 5.688
  Phosphate (umol/l): 0.078 - 2.980
  Silicate (umol/l): 0.946 - 69.094

Graphical representation

Depth range (m): 5 - 2505

Temperature range (°C): 3.229 - 23.913

Nitrate (umol/L): 0.229 - 42.002

Salinity (PPS): 34.406 - 36.595

Oxygen (ml/l): 1.298 - 5.688

Phosphate (umol/l): 0.078 - 2.980

Silicate (umol/l): 0.946 - 69.094
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Euphausia gibboides

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTTGTGCATGAGCTGGGATGGTAGGCACCTCATTAAGATTAATTATTCGAGCTGAGCTAGGCCACCCAGGTAGATTAATTGGAGAT---GATCAAATTTACAATGTGGTAGTCACAGCCCATGCTTTCGTTATAATTTTCTTCATGGTAATACCAATTATAATTGGTGGATTTGGAAATTGATTAGTACCACTTATACTAGGAGCACCAGACATGGCTTTCCCACGAATAAACAATATAAGATTTTGGCTTCTACCTCCCTCATTAACCCTATTGCTTGGAAGAGGTTTAGTTGAAAGAGGGGTTGGGACAGGATGAACTGTCTACCCTCCTTTATCTGCAGGAATTGCCCATGCTGGTGCATCCGTAGATATAGGAATCTTTTCTCTTCATATTGCGGGGGCTTCTTCTATTTTAGGAGCTGTAAATTTTATTACAACTGTTATTAATATACGATCTGCCGGGATAACTATAGACCGAATCCCATTATTTGTGTGATCAGTATTTATTACAGCAATTTTACTTCTTCTATCATTACCAGTTCTAGCAGGTGCTATTACAATATTATTAACTGATCGTAATCTAAATACATCTTTCTTCGACCCTGCTGGTGGTGGAGACCCAATTTTATATCAACACTTGTTTTGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Euphausia gibboides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!