Overview
Distribution
depth in m: 0-500; horizontal distribution: Atlantic 40°N°-40°S, Pacific 30°-40°N, SE Pacific 10°N-40°S
-
Kylin, H. (1956). Die Gattungen der Rhodophyceen. C.W.K. Gleerup: Lund, Sweden. xv, 673 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=24
-
Boltovskoy D. (1999). South Atlantic Zooplankton. Backhuys Publishers, Leiden, 1706 pp. (1961). Geology of the Arctic. Proceedings of the first international Symposium on Arctic Geology, Calgary, 1960. Toronto University Press.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=21766
-
Brinton E (1962). The distribution of Pacific euphausiids. Bull. Scipps Inst. Oceanography, 8 (1): 51-269
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=22998
-
Ponomareva, L.A. (1963) The Euphausiids of the North Pacific, their Distribution and Ecology. Dokl. Acad. Nauk. SSSR. 1-142
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=23006
-
Mauchline, J. and Fisher, L.R. (1969) The Biology of Euphausiids. Advances in Marine Biology 7: 1-454
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=10060
Trusted
European waters (ERMS scope), FAO fishing area 67, Gulf of Mexico, Mediterranean Sea, North East Pacific, South Africa (country)
-
Gibbons, M.J., M. Barange & L. Hutchings (1995). Zoogeography and diversity of euphausiids around southern Africa. Marine Biology 123: 257-268.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6179
-
Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College Station, Texas.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145245
-
van der Land, J. (2001). Euphausiacea, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 284
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1397
-
Institute of Ocean Science Zooplankton Database
http://www.marinespecies.org/copepoda/aphia.php?p=sourcedetails&id=150286
Trusted
Ecology
Habitat
Known from seamounts and knolls
-
Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145453
Trusted
Mesopelagic
-
Census of Marine Zooplankton, 2007. Polarstern Cruise ANT-24-1. Identifications by J. Bradford-Grieve, L. Blanco Bercial, R. Escribano, M. Kuriyama, Y. Nishibe, N. Copley & P. Wiebe.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=145462
Trusted
Epipelagic
-
Census of Marine Zooplankton, 2007. Polarstern Cruise ANT-24-1. Identifications by J. Bradford-Grieve, L. Blanco Bercial, R. Escribano, M. Kuriyama, Y. Nishibe, N. Copley & P. Wiebe.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=145462
Trusted
Depth range based on 86 specimens in 1 taxon.
Water temperature and chemistry ranges based on 84 samples.
Environmental ranges
Depth range (m): 5 - 2505
Temperature range (°C): 3.229 - 23.913
Nitrate (umol/L): 0.229 - 42.002
Salinity (PPS): 34.406 - 36.595
Oxygen (ml/l): 1.298 - 5.688
Phosphate (umol/l): 0.078 - 2.980
Silicate (umol/l): 0.946 - 69.094
Graphical representation
Depth range (m): 5 - 2505
Temperature range (°C): 3.229 - 23.913
Nitrate (umol/L): 0.229 - 42.002
Salinity (PPS): 34.406 - 36.595
Oxygen (ml/l): 1.298 - 5.688
Phosphate (umol/l): 0.078 - 2.980
Silicate (umol/l): 0.946 - 69.094
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 84 samples.
Environmental ranges
Depth range (m): 5 - 2505
Temperature range (°C): 3.229 - 23.913
Nitrate (umol/L): 0.229 - 42.002
Salinity (PPS): 34.406 - 36.595
Oxygen (ml/l): 1.298 - 5.688
Phosphate (umol/l): 0.078 - 2.980
Silicate (umol/l): 0.946 - 69.094
Graphical representation
Depth range (m): 5 - 2505
Temperature range (°C): 3.229 - 23.913
Nitrate (umol/L): 0.229 - 42.002
Salinity (PPS): 34.406 - 36.595
Oxygen (ml/l): 1.298 - 5.688
Phosphate (umol/l): 0.078 - 2.980
Silicate (umol/l): 0.946 - 69.094
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Euphausia gibboides
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
TTTTGTGCATGAGCTGGGATGGTAGGCACCTCATTAAGATTAATTATTCGAGCTGAGCTAGGCCACCCAGGTAGATTAATTGGAGAT---GATCAAATTTACAATGTGGTAGTCACAGCCCATGCTTTCGTTATAATTTTCTTCATGGTAATACCAATTATAATTGGTGGATTTGGAAATTGATTAGTACCACTTATACTAGGAGCACCAGACATGGCTTTCCCACGAATAAACAATATAAGATTTTGGCTTCTACCTCCCTCATTAACCCTATTGCTTGGAAGAGGTTTAGTTGAAAGAGGGGTTGGGACAGGATGAACTGTCTACCCTCCTTTATCTGCAGGAATTGCCCATGCTGGTGCATCCGTAGATATAGGAATCTTTTCTCTTCATATTGCGGGGGCTTCTTCTATTTTAGGAGCTGTAAATTTTATTACAACTGTTATTAATATACGATCTGCCGGGATAACTATAGACCGAATCCCATTATTTGTGTGATCAGTATTTATTACAGCAATTTTACTTCTTCTATCATTACCAGTTCTAGCAGGTGCTATTACAATATTATTAACTGATCGTAATCTAAATACATCTTTCTTCGACCCTGCTGGTGGTGGAGACCCAATTTTATATCAACACTTGTTTTGA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Euphausia gibboides
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
