Overview

Distribution

depth in m: 0-700; horizontal distribution: endemic to the eastern tropical Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Maine
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Type for Euphausia eximia Hansen
Catalog Number: USNM 45032
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: male;
Preparation: Alcohol (Ethanol)
Year Collected: 1904
Locality: Off Peru, Peru, South Pacific Ocean
Depth (m): 549
Vessel: Albatross R/V
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 14 specimens in 1 taxon.
Water temperature and chemistry ranges based on 14 samples.

Environmental ranges
  Depth range (m): 50 - 900
  Temperature range (°C): 4.574 - 19.313
  Nitrate (umol/L): 1.362 - 44.713
  Salinity (PPS): 34.496 - 35.184
  Oxygen (ml/l): 0.223 - 5.343
  Phosphate (umol/l): 0.378 - 3.088
  Silicate (umol/l): 2.278 - 71.567

Graphical representation

Depth range (m): 50 - 900

Temperature range (°C): 4.574 - 19.313

Nitrate (umol/L): 1.362 - 44.713

Salinity (PPS): 34.496 - 35.184

Oxygen (ml/l): 0.223 - 5.343

Phosphate (umol/l): 0.378 - 3.088

Silicate (umol/l): 2.278 - 71.567
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Euphausia eximia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGAGCTTGGGCTGGTATGGTAGGTACTTCTTTAAGGCTAATTATTCGAGCCGAATTGGGTCACCCCGGGAGATTAATTGGAGAT---GATCAAATTTATAACGTAGTAGTTACAGCACACGCTTTCGTGATGATTTTTTTCATGGTTATACCAATTATAATTGGGGGATTTGGAAACTGGCTAGTCCCACTTATACTAGGGGCACCAGATATAGCATTCCCACGGATAAATAACATGAGGTTTTGATTATTACCCCCCTCATTAACTTTATTACTTGGTAGAGGCCTAGTAGAAAGAGGGGTTGGTACAGGATGAACCGTTTATCCTCCATTATCTGCAGGGATTGCACATGCTGGTGCATCAGTGGACATAGGAATTTTTTCACTCCATATTGCCGGAGCTTCGTCTATTTTAGGAGCTGTAAATTTTATTACAACTGTTATTAACATACGATCTGCGGGTATAACTATAGACCGTATCCCATTATTTGTGTGGTCAGTATTTATTACAGCGATTTTACTACTCTTGTCTCTACCAGTGTTGGCTGGGGCTATTACAATACTTCTAACTGATCGTAATTTAAATACTTCTTTCTTTGACCCAGCTGGTGGTGGAGACCCAATTTTATATCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Euphausia eximia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!