Overview
Distribution
depth in m: 0-700; horizontal distribution: endemic to the eastern tropical Pacific
-
Kylin, H. (1956). Die Gattungen der Rhodophyceen. C.W.K. Gleerup: Lund, Sweden. xv, 673 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=24
-
Brinton E (1962). The distribution of Pacific euphausiids. Bull. Scipps Inst. Oceanography, 8 (1): 51-269
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=22998
-
Mauchline, J. and Fisher, L.R. (1969) The Biology of Euphausiids. Advances in Marine Biology 7: 1-454
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=10060
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Gulf of Maine
-
Johnson CL, Runge JA, Curtis KA, Durbin EG, Hare JA, Incze LS, Link J, Melvin GD, O'Brien TD, Van Guelpen, L (in revision) Biodiversity and ecosystem function in the Gulf of Maine: pattern and role of zooplankton and pelagic nekton. PLoS One.
http://www.vliz.be/vmdcdata/masdea/masdea.php?p=sourcedetails&id=148111
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Physical Description
Type Information
Type for Euphausia eximia Hansen
Catalog Number: USNM 45032
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: male;
Preparation: Alcohol (Ethanol)
Year Collected: 1904
Locality: Off Peru, Peru, South Pacific Ocean
Depth (m): 549
Vessel: Albatross R/V
Catalog Number: USNM 45032
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: male;
Preparation: Alcohol (Ethanol)
Year Collected: 1904
Locality: Off Peru, Peru, South Pacific Ocean
Depth (m): 549
Vessel: Albatross R/V
- Type:
© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Trusted
Ecology
Habitat
Known from seamounts and knolls
-
Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145453
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Depth range based on 14 specimens in 1 taxon.
Water temperature and chemistry ranges based on 14 samples.
Environmental ranges
Depth range (m): 50 - 900
Temperature range (°C): 4.574 - 19.313
Nitrate (umol/L): 1.362 - 44.713
Salinity (PPS): 34.496 - 35.184
Oxygen (ml/l): 0.223 - 5.343
Phosphate (umol/l): 0.378 - 3.088
Silicate (umol/l): 2.278 - 71.567
Graphical representation
Depth range (m): 50 - 900
Temperature range (°C): 4.574 - 19.313
Nitrate (umol/L): 1.362 - 44.713
Salinity (PPS): 34.496 - 35.184
Oxygen (ml/l): 0.223 - 5.343
Phosphate (umol/l): 0.378 - 3.088
Silicate (umol/l): 2.278 - 71.567
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 14 samples.
Environmental ranges
Depth range (m): 50 - 900
Temperature range (°C): 4.574 - 19.313
Nitrate (umol/L): 1.362 - 44.713
Salinity (PPS): 34.496 - 35.184
Oxygen (ml/l): 0.223 - 5.343
Phosphate (umol/l): 0.378 - 3.088
Silicate (umol/l): 2.278 - 71.567
Graphical representation
Depth range (m): 50 - 900
Temperature range (°C): 4.574 - 19.313
Nitrate (umol/L): 1.362 - 44.713
Salinity (PPS): 34.496 - 35.184
Oxygen (ml/l): 0.223 - 5.343
Phosphate (umol/l): 0.378 - 3.088
Silicate (umol/l): 2.278 - 71.567
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Euphausia eximia
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
GGAGCTTGGGCTGGTATGGTAGGTACTTCTTTAAGGCTAATTATTCGAGCCGAATTGGGTCACCCCGGGAGATTAATTGGAGAT---GATCAAATTTATAACGTAGTAGTTACAGCACACGCTTTCGTGATGATTTTTTTCATGGTTATACCAATTATAATTGGGGGATTTGGAAACTGGCTAGTCCCACTTATACTAGGGGCACCAGATATAGCATTCCCACGGATAAATAACATGAGGTTTTGATTATTACCCCCCTCATTAACTTTATTACTTGGTAGAGGCCTAGTAGAAAGAGGGGTTGGTACAGGATGAACCGTTTATCCTCCATTATCTGCAGGGATTGCACATGCTGGTGCATCAGTGGACATAGGAATTTTTTCACTCCATATTGCCGGAGCTTCGTCTATTTTAGGAGCTGTAAATTTTATTACAACTGTTATTAACATACGATCTGCGGGTATAACTATAGACCGTATCCCATTATTTGTGTGGTCAGTATTTATTACAGCGATTTTACTACTCTTGTCTCTACCAGTGTTGGCTGGGGCTATTACAATACTTCTAACTGATCGTAATTTAAATACTTCTTTCTTTGACCCAGCTGGTGGTGGAGACCCAATTTTATATCAACACTTA
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Euphausia eximia
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
