Overview

Distribution

depth in m: 50-400; horizontal distribution: Eastern Tropical Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Type for Euphausia distinguenda Hansen
Catalog Number: USNM 44961
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Year Collected: 1904
Locality: Off Peru, Peru, South Pacific Ocean
Depth (m): 549
Vessel: Albatross R/V
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 14 specimens in 1 taxon.
Water temperature and chemistry ranges based on 14 samples.

Environmental ranges
  Depth range (m): 307 - 549
  Temperature range (°C): 8.106 - 13.294
  Nitrate (umol/L): 26.132 - 40.711
  Salinity (PPS): 34.611 - 35.411
  Oxygen (ml/l): 0.223 - 0.971
  Phosphate (umol/l): 2.149 - 3.058
  Silicate (umol/l): 28.642 - 47.673

Graphical representation

Depth range (m): 307 - 549

Temperature range (°C): 8.106 - 13.294

Nitrate (umol/L): 26.132 - 40.711

Salinity (PPS): 34.611 - 35.411

Oxygen (ml/l): 0.223 - 0.971

Phosphate (umol/l): 2.149 - 3.058

Silicate (umol/l): 28.642 - 47.673
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Euphausia distinguenda

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTGGTGCGTGAGCAGGAATAGTGGGTACCTCGTTAAGATTAATCATTCGAGCTGAATTAGGGCACCCGGGTAGACTGATTGGAGAT---GATCAAATTTATAACGTTGTAGTTACAGCCCATGCTTTTGTAATAATTTTTTTCATGGTTATACCGATTATAATTGGTGGATTTGGAAACTGACTTGTTCCTCTGATGCTAGGGGCCCCGGATATAGCATTTCCACGAATGAACAATATGAGGTTTTGACTTTTACCACCTTCGTTAACTCTTTTATTAGGTAGAGGGTTAGTAGAAAGTGGTGTTGGAACAGGTTGAACTGTTTACCCTCCTTTAGCGGGAGGAATTGCTCATGCTGGGGCTTCAGTAGACATGGGTATTTTTTCACTGCATATTGCTGGGGCTTCGTCCATTCTAGGAGCGGTTAACTTTATTACAACTGTTATTAATATGCGATCTGCAGGTATAACTATAGACCGAATTCCATTATTTGTTTGGTCAGTTTTCATTACTGCAATTTTACTTCTTCTTTCATTACCAGTGCTAGCAGGCGCTATTACGATACTTTTAACTGACCGTAATCTTAATACATCTTTCTTCGACCCTGCCGGAGGAGGGGACCCTATTCTATAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Euphausia distinguenda

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!