Overview
Distribution
depth in m: 100-300; horizontal distribution: subtropical in all basins
-
Kylin, H. (1956). Die Gattungen der Rhodophyceen. C.W.K. Gleerup: Lund, Sweden. xv, 673 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=24
-
Boltovskoy D. (1999). South Atlantic Zooplankton. Backhuys Publishers, Leiden, 1706 pp. (1961). Geology of the Arctic. Proceedings of the first international Symposium on Arctic Geology, Calgary, 1960. Toronto University Press.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=21766
-
Brinton E (1962). The distribution of Pacific euphausiids. Bull. Scipps Inst. Oceanography, 8 (1): 51-269
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=22998
-
Ponomareva, L.A. (1963) The Euphausiids of the North Pacific, their Distribution and Ecology. Dokl. Acad. Nauk. SSSR. 1-142
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=23006
-
Mauchline, J. and Fisher, L.R. (1969) The Biology of Euphausiids. Advances in Marine Biology 7: 1-454
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=10060
-
Brinton, E. (1975) Euphausiids of southeast Asian waters. Naga Report, 4 (5):1-287
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=23000
-
Mauchline J. (1980), The Biololgy of Mysids and Euphausiids. Advances in marine Biology (London), 18, 1-680
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=23005
-
Weigmann, R. (1970). Zur Ökologie und Ernährungsbiologie der Euphausiaceen (Crustacea) im Arabischen Meer. Meteror Forschungsergebnisse, Reihe D, 5, 11-52
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=23008
Trusted
European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Mexico, Mediterranean Sea, North West Atlantic, South Africa (country)
-
Gibbons, M.J., M. Barange & L. Hutchings (1995). Zoogeography and diversity of euphausiids around southern Africa. Marine Biology 123: 257-268.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6179
-
Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College Station, Texas.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145245
-
van der Land, J. (2001). Euphausiacea, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 284
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1397
-
Koukouras, Athanasios. (2010). Check-list of marine species from Greece. Aristotle University of Thessaloniki. Assembled in the framework of the EU FP7 PESI project.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=142068
Trusted
Ecology
Habitat
Known from seamounts and knolls
-
Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145453
Trusted
Epipelagic
-
Census of Marine Zooplankton, 2006. NOAA Ship Ronald H Brown, deployment RHB0603, Sargasso Sea. Peter Wiebe, PI. Identifications by L. Bercial, N. Copley, A. Cornils, L. Devi, H. Hansen, R. Hopcroft, M. Kuriyama, H. Matsuura, D. Lindsay, L. Madin, F. Pagè
http://www.vliz.be/vmdcdata/masdea/masdea.php?p=sourcedetails&id=145459
Trusted
Depth range based on 223 specimens in 1 taxon.
Water temperature and chemistry ranges based on 222 samples.
Environmental ranges
Depth range (m): 5 - 5422.5
Temperature range (°C): 2.451 - 21.473
Nitrate (umol/L): 0.040 - 39.883
Salinity (PPS): 34.057 - 36.952
Oxygen (ml/l): 1.351 - 5.846
Phosphate (umol/l): 0.052 - 2.822
Silicate (umol/l): 0.844 - 77.234
Graphical representation
Depth range (m): 5 - 5422.5
Temperature range (°C): 2.451 - 21.473
Nitrate (umol/L): 0.040 - 39.883
Salinity (PPS): 34.057 - 36.952
Oxygen (ml/l): 1.351 - 5.846
Phosphate (umol/l): 0.052 - 2.822
Silicate (umol/l): 0.844 - 77.234
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 222 samples.
Environmental ranges
Depth range (m): 5 - 5422.5
Temperature range (°C): 2.451 - 21.473
Nitrate (umol/L): 0.040 - 39.883
Salinity (PPS): 34.057 - 36.952
Oxygen (ml/l): 1.351 - 5.846
Phosphate (umol/l): 0.052 - 2.822
Silicate (umol/l): 0.844 - 77.234
Graphical representation
Depth range (m): 5 - 5422.5
Temperature range (°C): 2.451 - 21.473
Nitrate (umol/L): 0.040 - 39.883
Salinity (PPS): 34.057 - 36.952
Oxygen (ml/l): 1.351 - 5.846
Phosphate (umol/l): 0.052 - 2.822
Silicate (umol/l): 0.844 - 77.234
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Euphausia brevis
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
TTATACTTTATTTTCGGAGCTTGAGCTGGGATAGTAGGTACCTCTTTAAGTTTAATTATTCGAGCTGAATTAGGACACCCTGGGAGATTAATTGGAGAT---GATCAAATTTATAACGTGGTAGTAACAGCACATGCCTTTGTTATAATTTTCTTTATGGTTATACCAATTATAATTGGAGGATTTGGAAACTGATTAGTTCCTCTTATACTAGGAGCCCCAGATATGGCCTTCCCACGAATAAACAATATAAGATTTTGGTTACTACCACCTTCATTAACTTTATTGCTTGGAAGAGGCCTAGTTGAAAGTGGAGTTGGTACAGGATGAACTGTCTATCCTCCACTATCTGCAGGAATTGCACATGCTGGTGCATCAGTAGATATAGGAATTTTTTCACTTCATATTGCAGGGGCTTCCTCTATTTTAGGAGCCGTAAACTTTATTACAACTGTTATTAATATACGATCTGCAGGTATAACTATAGACCGTATTCCACTATTTGTTTGATCAGTATTTATTACAGCAATTCTTTTACTTTTATCTCTACCAGTGTTAGCTGGAGCTATTACAATACTTTTAACTGATCGTAATTTGAATACTTCTTTCTTTGACCCAGCTGGTGGTGGAGACCCAATTTTATATCAACACTTATTTTGATTT
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Euphausia brevis
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
