Overview

Distribution

depth in m: 100-300; horizontal distribution: subtropical in all basins
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Epipelagic
  • Census of Marine Zooplankton, 2006. NOAA Ship Ronald H Brown, deployment RHB0603, Sargasso Sea. Peter Wiebe, PI. Identifications by L. Bercial, N. Copley, A. Cornils, L. Devi, H. Hansen, R. Hopcroft, M. Kuriyama, H. Matsuura, D. Lindsay, L. Madin, F. Pagè
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 223 specimens in 1 taxon.
Water temperature and chemistry ranges based on 222 samples.

Environmental ranges
  Depth range (m): 5 - 5422.5
  Temperature range (°C): 2.451 - 21.473
  Nitrate (umol/L): 0.040 - 39.883
  Salinity (PPS): 34.057 - 36.952
  Oxygen (ml/l): 1.351 - 5.846
  Phosphate (umol/l): 0.052 - 2.822
  Silicate (umol/l): 0.844 - 77.234

Graphical representation

Depth range (m): 5 - 5422.5

Temperature range (°C): 2.451 - 21.473

Nitrate (umol/L): 0.040 - 39.883

Salinity (PPS): 34.057 - 36.952

Oxygen (ml/l): 1.351 - 5.846

Phosphate (umol/l): 0.052 - 2.822

Silicate (umol/l): 0.844 - 77.234
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Euphausia brevis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTATACTTTATTTTCGGAGCTTGAGCTGGGATAGTAGGTACCTCTTTAAGTTTAATTATTCGAGCTGAATTAGGACACCCTGGGAGATTAATTGGAGAT---GATCAAATTTATAACGTGGTAGTAACAGCACATGCCTTTGTTATAATTTTCTTTATGGTTATACCAATTATAATTGGAGGATTTGGAAACTGATTAGTTCCTCTTATACTAGGAGCCCCAGATATGGCCTTCCCACGAATAAACAATATAAGATTTTGGTTACTACCACCTTCATTAACTTTATTGCTTGGAAGAGGCCTAGTTGAAAGTGGAGTTGGTACAGGATGAACTGTCTATCCTCCACTATCTGCAGGAATTGCACATGCTGGTGCATCAGTAGATATAGGAATTTTTTCACTTCATATTGCAGGGGCTTCCTCTATTTTAGGAGCCGTAAACTTTATTACAACTGTTATTAATATACGATCTGCAGGTATAACTATAGACCGTATTCCACTATTTGTTTGATCAGTATTTATTACAGCAATTCTTTTACTTTTATCTCTACCAGTGTTAGCTGGAGCTATTACAATACTTTTAACTGATCGTAATTTGAATACTTCTTTCTTTGACCCAGCTGGTGGTGGAGACCCAATTTTATATCAACACTTATTTTGATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Euphausia brevis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!