Overview

Comprehensive Description

General Description

A very large (8.5-11.5 cm wingspan) long-winged moth. The body is brown edged with longitudinal black stripes. The doubled postmedian line on both wings is the only well developed cross line. There are also a number of black longitudinal streaks on the outer half of the forewing and small, light discal spots. Our other large dark sphinx moths from south of the boreal forest are grey, not brown. The adults are similar, but females are larger than males. The larvae are large, pale green with granular skin and pale diagonal lateral streaks. They are easily identified by the four prominent horns on the front end, hence the other common name, the Four-horned sphinx.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Nova Scotia west to the eastern edge of Alberta, south to Florida and Mexico. There is a single Alberta record for a fresh female collected at MV light on the edge of the Red Deer River north of Jenner.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Frequents hardwood woodland.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Larvae are reported to feed on elm, birch, basswood and cherry.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

The adults are nocturnal and come to light. There is a single annual brood, which overwinter as pupae. Mature larvae are most often encountered after they wander from the host tree and seek a place with loose soil in which to pupate. The only Alberta record is for June 3, 2004.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ceratomia amyntor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTCTTTTAATTCGAGCAGAATTAGGTAACCCAGGATCATTAATCGGAGATGATCAAATTTACAATACAATTGTTACAGCTCACGCATTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGACTAATTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAACATAAGTTTTTGACTCTTACCCCCTTCTTTAATATTACTAATTTCTAGTAGTATTGTAGAAAATGGAGCCGGAACAGGTTGAACAGTATATCCCCCATTATCTTCTAATATTGCACATAGAGGAAGATCTGTTGATTTAGCTATTTTCTCTTTACATTTAGCAGGTATTTCATCTATTTTAGGAGCTATTAATTTTATCACTACAATTATTAATATGCGAATTAATAATATAACATTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTTTTATTATTACTATCCTTGCCTGTTTTAGCGGGAGCAATTACTATATTATTAACAGATCGAAATTTAAATACATCATTCTTTGATCCTGCAGGTGGAGGAGACCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ceratomia amyntor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Ceratomia amyntor

The Elm sphinx, (Ceratomia amyntor), sometimes called the Four-horned Sphinx, is a North American species of moth in the Sphingidae family. It has a wingspan of 3¼ - 4½ inches (8.2 - 11.5 cm). As the name suggests, the larvae (caterpillars) feed on elm trees (Ulmus), but they can also be found feeding on birch (Betula), basswood (Tilia), and cherry (Prunus). When the caterpillars are ready, they crawl to the bottom of the host tree, where they crawl underneath the soil and pupate and may overwinter underground if late enough into the year.

Range[edit]

C. amyntor can be found from Nova Scotia west to Alberta and western North Dakota and Colorado; south to central Florida, the Gulf Coast, Texas, and New Mexico.

Status[edit]

Unthreatened.

Life cycle[edit]

C amyntor adults fly as a single brood in the northern portions from June–July. There are two broods further south, flying later into the year, and five broods have been confirmed in Louisiana from March–October.

Egg[edit]

Tiny, translucent, lime-green eggs deposited on the underside of host leaves. The shells are transparent and pearly after hatching.

Larva[edit]

Larva

Larvae come in two different color phases; a green phase, and a dark phase which differs in shades of brown, orange, and somewhat of a pinkish brown. Larvae complete all five instars within approximately one month. The first instar is the same shade of green as its egg. As the larva progresses through its instars, change in structure is noticeable. The caterpillar sports four, long, horn-like projections- in addition to the tail horn- from above its head, which is why the Elm Sphinx is sometimes called the Four-horned Sphinx.

Pupa[edit]

As with other Sphingidae, C. amyntor goes through a "wandering" phase where it stops feeding and burrows into the soil in order to pupate. Before pupating, the larva shrinks a considerable amount and then sheds its remaining skin that distinguishes it as a caterpillar, revealing its shell-like pupa.

Imago[edit]

The overall coloring of the imago, or adult, Elm Sphinx is a gray-brown with wavy markings covering the forewings. In the upper center of the forewings, as with other Ceratomia species, there is a small white dot. The hindwings are a plain gray with a darker band running the length of the near-edge. The outer ends of the forewings and hindwings are both dashed with a light-dark-light pattern. Three broken, dark bands run the length of the body from the thorax to the tip of the abdomen. The antennae are stiff and wiry and have hook at the tips. Some specimens have a prominent splash of bright white on their upper head and wings and stand out considerably from other C. amyntor.

Elm Sphinx, Ceratomia amyntor, imago, Durham, North Carolina, United States

Food plants[edit]

See also[edit]

References[edit]

  1. ^ "CATE Creating a Taxonomic eScience - Sphingidae". Cate-sphingidae.org. Retrieved 2011-11-01. 
  • Villiard, P. (1969). Moths and How to Rear Them. New York: Funk & Wagnalls. LCCN 68-27516
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!