Overview

Brief Summary

A large moth from the Sphingidae family.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Wil Heeney

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Compsilura concinnata is endoparasitoid of larva of Deilephila elpenor

Foodplant / open feeder
caterpillar of Deilephila elpenor grazes on live leaf of Fuchsia

Foodplant / open feeder
caterpillar of Deilephila elpenor grazes on live leaf of Impatiens

Plant / pollenated
adult of Deilephila elpenor pollenates or fertilises flower of Platanthera bifolia
Other: major host/prey

Animal / parasitoid / endoparasitoid
larva of Drino lota is endoparasitoid of larva of Deilephila elpenor
Other: major host/prey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Eyes are anti-reflective: elephant hawk-moth
 

Eyes of nocturnal moths are anti-reflective due to nanoscale protrusions.

     
  "Most moth eyes are made up of hexagonal sectors, each of which is filled with thousands of rows of nipple-like protrusions measuring only 300 nanometers. The value of this structure to the moth is that it interferes with transmission and reflection of light, which may protect it from predators as it forages in the moonlight." (Courtesy of the Biomimicry Guild)

"The eyes of moths have two characteristic optical structures that  probably function to increase the light sensitivity: the tapetal mirror  and the corneal nipple array (Miller, 1979). The tapetum is composed of  tracheoles at the proximal portion of the rhabdom and reflects  unabsorbed light back into the rhabdom, thus providing a second chance  for light to be absorbed. The corneal nipple array, known as the  ‘moth-eye’ structure, is a set of protuberances of height about 200•nm,  acting as a thin-film antireflection coating. These structures are  basically retained in the apposition eyes of true butterflies, but all  species in the family Papilionidae lack both (Bernhard et al., 1970;  Stavenga et al., 2006).” (Takemura et al. 2007)

  Learn more about this functional adaptation.
  • Takemura, S-Y.; Stavenga, D.G.; Arikawa, K. 2007. Absence of eye shine and tapetum in the heterogeneous eye of Anthocharis butterflies (Pieridae). The Journal of Experimental Biology. 210: 3075-3081.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Deilephila elpenor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTACTAATTCGAGCAGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTACAATACAATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTAATTCCTTTAATATTAGGAGCACCTGATATAGCATTCCCCCGAATAAATAACATAAGATTTTGACTTTTACCCCCATCCCTAACCCTTTTAATTTCTAGAAGTATTGTTGAAAATGGAGCAGGAACTGGTTGAACAGTTTATCCACCCCTATCCTCTAATATCGCCCATAGAGGAAGCTCAGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCTTCAATTATAGGAGCTGTAAATTTTATTACAACTATTATCAATATACGAATTAATAACTTATCATTTGATCAAATACCACTATTTGTTTGAGCTGTTGGTATTACAGCATTTTTATTATTATTATCTTTACCAGTATTAGCTGGTGCAATTACAATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCTATCTTATATCAACATCTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Deilephila elpenor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 35
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Deilephila elpenor

Deilephila elpenor, known as the Elephant Hawk-moth, is a large moth of the Sphingidae family.

Range[edit]

The species is found throughout Britain and Ireland. Its range extends across Europe, Russia, and into China, northern parts of the Indian subcontinent, Japan and Korea (though not Taiwan). Introduced specimens have been found in British Columbia. In most of their range, the adults are seen from May to July and the caterpillars from July to September, when they pupate. However in some parts of the Mediterranean and China the adults may be seen from April on, sometimes having two broods in a year.

Appearance[edit]

Caterpillar in "elephant" pose
Caterpillar showing head and postabdominal spine
Caterpillar showing head (top) and 8 abdominal prolegs
Caterpillar in "snake" pose
Pupa
Imago

Larva[edit]

The larva is about 75 millimetres (3.0 in) long, green and brown in colour. Like most hawk moth caterpillars, they have a backward curving spine or "horn" on the final abdominal segment. The anterior of the caterpillar appears to have the shape of a trunk-like snout. It is this elephant look, rather than its large size, that gives the moth its name. When startled, the caterpillar draws its trunk into its foremost body segment. This posture resembles a snake with a large head and four large eye-like patches. Caterpillars are preyed upon by birds, but these shy away (at least for some time) from caterpillars in "snake" pose. It is not known whether the birds take the caterpillar to actually resemble a snake, or are frightened by the sudden change of a familiar prey item into an unusual and boldly-patterned shape.[2]

The preferred food plants of the caterpillar are willowherb (Epilobium) and bedstraw (Galium), though it will also take fuchsias.

Adult[edit]

The moth typically has a wing span of 50–70 mm (2.0–2.8 in). The upperside ground colour of head, thorax and abdomen is khaki, excepting the pink inner edges and median line of the tegulae, posterior margin of thorax, base of abdomen, abdominal median line and terminal abdominal segments. The upperside of forewing is also khaki, except the pink costa, a pink narrow, median band extending from the inner margin to Medial vein 3, a pink and narrow postmedian band which extends from the inner margin to the apex, and a pink marginal band.The basal half of the hindwing upperside is black, distal half pink (the distal edge of black area is almost straight and parallel to the outer margin). f. unicolor Tutt, has no pink coloration on the forewing

The imago (adult) feeds at night, and often takes nectar from garden plants like Honeysuckles (Lonicera) and petunias, so it is quite often seen in urban settings in the evening. It is spectacularly coloured, seeming to shimmer with green and red when in motion. The adult moths are eaten by some species of bats.

Night vision[edit]

This species possesses good night or scotopic vision. Its eye includes two different kinds of ommatidium; each contains nine light sensitive cells, of which seven contain a pigment whose absorption spectrum peaks in the green part of the spectrum, but in one type the remaining two receptors have peak absorption in the blue and in the other type they have peak reception in the ultra violet. The moth therefore has the cellular prerequisites for trichromatic colour vision. Adults have been shown to be capable of making colour discriminations at night-time levels of illumination, and they sustain these discriminations despite changes in the spectral content of the incident light; that is, they show colour constancy.[3]

Subspecies[edit]

Two subspecies, Deilephila elpenor elpenor and Deilephila elpenor lewisii, were recognised in the past, but they are no longer regarded as well distinguished. Similarly the subspecies Deilephila elpenor szechuana is now thought to be a synonym for Deilephila elpenor elpenor. The subspecies Deilephila elpenor macromera, found in southern China, northern India, Bhutan and Myanmar, is still regarded as distinct.

The related species, the Small Elephant Hawk-moth Deilephila porcellus and Chitral Elephant Hawk-moth Deilephila rivularis are similar but smaller and less colourful.

References[edit]

  1. ^ "CATE Creating a Taxonomic eScience - Sphingidae". Cate-sphingidae.org. Archived from the original on 2012-10-15. Retrieved 2011-10-26. 
  2. ^ Martin Stevens (2005). "The role of eyespots as anti-predator mechanisms, principally demonstrated in the Lepidoptera". Biological Reviews 80 (4): 573–588. doi:10.1017/S1464793105006810. PMID 16221330. 
  3. ^ Almut Kelber, Anna Balkenius & Eric J. Warrant (2002). "Scotopic colour vision in nocturnal hawkmoths". Nature 419 (6910): 922–925. doi:10.1038/nature01065. PMID 12410310. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!