Overview

Comprehensive Description

General Description

A fairly large (4.5-6.2 cm. wingspan) day-flying moth with narrow, pointed translucent wings. The wings have dark olive brown (forewing) or red brown (hindwing) bases, a wide dark outer margin, and the veins are lined with dark scales. The heavy body is covered in dark olive-brown hairs, except for a wide dark band on the abdomen. In Alberta, it can be mistaken only for the Snowberry Clearwing, which is smaller, has narrow dark outer margins on the wings, and large yellow patches on the sides of the lower abdomen. The very similar Slender Clearwing (H. gracilis) has been reported from eastern Saskatchewan and may eventually turn up in eastern Alberta. H. thysbe can always be told from other species of Hemaris by the row of dark scales bisecting the forewing discal cell (absent in other Hemaris species). Royal Alberta Museum page
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Occurs throughout most of the wooded parts of eastern North America, west accross the boreal forest region to B.C. and Washington. In Alberta it is found throughput the boreal forest, the northern part of the aspen parklands and in the foothills and lower elevations in the mountains.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Hemaris thysbe may be found as far north as Alaska and the Northwest Territories. In the continental United States, Hemaris thysbe they occur west to Oregon. They are most common in the eastern part of the United States, and as far south as Florida and Texas. (Lawrence, 1999)

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The average wing span of hummingbird moths range from 4 to 5.5 cm. In adults, the wings are initially dark red to almost black. After their first flight however, some of the scales fall off, leaving clear spots with no scales. Thus, the wings are typically clear with a reddish to brown color border. The forewing cell has a medial row of scales and a dark margin. The body is spindle shaped and varies in color from olive green to reddish-brown. These moths lack the tympana possessed by most other moths. Their antennae are thickened from the base outward, usually to the middle only, and curved at the end. The larva are yellowish-green with darker green lines and reddish brown to dark brown.

(Struttmann, 1999)

Average mass: 3 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Open woodlands, edges and clearings and adjacent meadows.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The most common habitats for Hemaris thysbe include cultivated flower gardens, meadows, and forest edges. Hummingbird moths can fly long distances and are migratory. Only a few are able to cross desert regions because the scarcity of food and water. Their flight period is from May to September. (Holzberg, 1999)

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

No Alberta data. Elsewhere reported to use various shrubs, including Viburnum, Honeysuckle (Lonicera), Cherry (Prunus), Hawthorn (Craetagus) and snowberry (Symphoricarpos).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Hummingbird moths have a proboscis used to suck nectar from flowers. They feed from a variety of flowers, including honeysuckle, beebalm, lilac, snowberry and cranberry. They hover above the flowers and are often mistaken for hummingbirds. Their caterpillars feed on a variety of hosts, including honeysuckle, snowberry, hawthorns, cherries and plums. (Nicholson, 1999)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Flowering Plants Visited by Hemaris thysbe in Illinois

Hemaris thysbe Fabricius: Sphingidae, Lepidoptera
(observations are from Robertson, Reed, Hilty, Clinebell, Smith & Snow, Hapeman, Stoutamire, Guignard, Macior, and Luer; this moth is the Hummingbird Clearwing)

Asteraceae: Cirsium altissimum sn (Rb), Cirsium discolor sn (Rb), Echinacea pallida sn (Rb); Boraginaceae: Mertensia virginica sn (Rb); Caprifoliaceae: Viburnum prunifolium sn (Rb); Fabaceae: Orbexilum onobrychis sn (Rb); Geraniaceae: Geranium maculatum sn (Rb); Lamiaceae: Monarda fistulosa sn (Rb, Re, H, Cl); Orchidaceae: Platanthera blephariglottis sn (SS), Platanthera lacera sn (Lu), Platanthera peramoena sn fq (Hpm), Platanthera psychodes sn (Stm, Gu); Polemoniaceae: Phlox divaricata laphamii sn (Rb), Polemonium reptans sn (Rb); Ranunculaceae: Delphinium tricorne sn np (Mc)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Adults are on the wing late May - July.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

The Hummingbird Clearwing is most often encountered during the day while nectaring at flowers. Unlike the Snowberry Clearwing, it is frequents open woodlands throughout much of the Boreal Forest region. It rarely alights, and the wingbeat is so rapid the wings are a blur, and thus it greatly resembles it's namesake, the hummingbird.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

During winter, the larvae burrow in the soil and overwinter as hard-shelled, brown pupae. In May or June, hummingbird moths emerge from the pupae. They then deposit spherical green eggs on the undersides of leaves (usually of host plants). A week later, the larvae hatch and feed on fruit and leaves. Four weeks later, they are fully developed. Pupation occurs in the soil, and adults emerge 2 to 4 weeks later to lay a second generation of eggs. (Lawrence, 1999)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hemaris thysbe

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACTTTATACTTTATTTTCGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCAGAATTAGGTAACCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTAACAGCCCATGCATTTATTATAATTTTCTTCATAGTTATACCTATTATAATTGGTGGATTTGGAAACTGACTTGTACCTTTAATATTAGGTGCACCTGATATGGCATTCCCCCGAATAAATAATATGAGATTTTGACTTCTTCCACCTTCTTTAACCCTTCTTATTTCTAGAAGTATCGTTGAAAATGGTGCTGGTACTGGATGAACAGTTTACCCCCCTTTATCAGCAAATATCGCTCATAGAGGAAGATCAGTAGATTTAGCAATTTTTTCTCTACACTTAGCTGGTATTTCCTCAATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGAATCAACAATTTATCATTTGATCAAATACCTTTATTTGTATGAGCTGTTGGAATTACAGCATTTTTATTACTACTATCTTTACCAGTATTAGCAGGAGCTATTACTATACTTCTTACAGATCGAAATTTAAATACATCATTTTTTGATCCGGCTGGAGGAGGAGATCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hemaris thysbe

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

No concerns.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is not currently considered threatened on the state, federal, or global level.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Larvae of the closely related sphinx moth, called hornworms, are pests to tobacco and tomato plants as they oftentimes feed on them.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Hummingbird moths have little or no economic importance to humans. They are pollinators of some flowers, including the dune primrose. (Nicholson, 1999)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hemaris thysbe

Hemaris thysbe, or the Hummingbird Clearwing, is a moth of the Sphingidae family. It lives in Alaska and the Northwest Territories south through British Columbia to Oregon; east through the Great Plains and the Great Lakes area to Maine and Newfoundland; south to Florida and Texas.

Hemaris thysbe or Hummingbird Clearwing Moth

Adults are frequently mistaken for hummingbirds or bees because of their fast-moving wings and coloration. They have a two inch wingspan.

The caterpillars eat viburnum, hawthorn, honeysuckle, and a few types of fruit trees.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!