Overview

Comprehensive Description

General Description

A fairly large (4.5-6.2 cm. wingspan) day-flying moth with narrow, pointed translucent wings. The wings have dark olive brown (forewing) or red brown (hindwing) bases, a wide dark outer margin, and the veins are lined with dark scales. The heavy body is covered in dark olive-brown hairs, except for a wide dark band on the abdomen. In Alberta, it can be mistaken only for the Snowberry Clearwing, which is smaller, has narrow dark outer margins on the wings, and large yellow patches on the sides of the lower abdomen. The very similar Slender Clearwing (H. gracilis) has been reported from eastern Saskatchewan and may eventually turn up in eastern Alberta. H. thysbe can always be told from other species of Hemaris by the row of dark scales bisecting the forewing discal cell (absent in other Hemaris species). Royal Alberta Museum page
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Occurs throughout most of the wooded parts of eastern North America, west accross the boreal forest region to B.C. and Washington. In Alberta it is found throughput the boreal forest, the northern part of the aspen parklands and in the foothills and lower elevations in the mountains.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) The range is vast, from central Alaska and Labrador to southern Florida. It is however absent from most or all of U.S. states west of the Dakotas and eastern Texas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Hemaris thysbe may be found as far north as Alaska and the Northwest Territories. In the continental United States, Hemaris thysbe they occur west to Oregon. They are most common in the eastern part of the United States, and as far south as Florida and Texas. (Lawrence, 1999)

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The average wing span of hummingbird moths range from 4 to 5.5 cm. In adults, the wings are initially dark red to almost black. After their first flight however, some of the scales fall off, leaving clear spots with no scales. Thus, the wings are typically clear with a reddish to brown color border. The forewing cell has a medial row of scales and a dark margin. The body is spindle shaped and varies in color from olive green to reddish-brown. These moths lack the tympana possessed by most other moths. Their antennae are thickened from the base outward, usually to the middle only, and curved at the end. The larva are yellowish-green with darker green lines and reddish brown to dark brown.

(Struttmann, 1999)

Average mass: 3 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Open woodlands, edges and clearings and adjacent meadows.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Adults are usually seen at flowers in gardens or flowery meadows in most of the range. They are otherwise not often seen. Viburnums are typically associated with wooded habitats but sometimes also occur in successional shrubby habitats. Most likely larvae occur mostly along wooded edges southward. Based on the extensive boreal range, taiga and openings in boreal forests may also be typical habitats in places where Ericaceae are used as foodplants. Probably any open or lightly wooded habitat with nectar sources is potential adult habitat. It is not really known whether more interior portions of deciduous forests are really habitats or not. Viburnums are often among the more common understory shrubs and even small trees (e.g. V. prunifolium) in such forests where native understory still occurs. It is not known whether adults fly into forests to oviposit or stay mostly in sunnier, warmer, microhabitats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The most common habitats for Hemaris thysbe include cultivated flower gardens, meadows, and forest edges. Hummingbird moths can fly long distances and are migratory. Only a few are able to cross desert regions because the scarcity of food and water. Their flight period is from May to September. (Holzberg, 1999)

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

No Alberta data. Elsewhere reported to use various shrubs, including Viburnum, Honeysuckle (Lonicera), Cherry (Prunus), Hawthorn (Craetagus) and snowberry (Symphoricarpos).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eastern larvae feed primarily, if not entirely, on species of Viburnum (Wagner, 2005). The compilation by Robinson et al. (2002) also includes reports on a few other Caprifoliaceae, but Tuttle (2009) and others suspect these may refer to H. diffinis. Reports of hawthorn are almost certainly incorrect and very likely arise from misinterpretation of terms like possumhaw or black haw which are used as common names for some species of Viburnum and Ilex. Tuttle (2007) reports that they also occur regularly on blueberry and cranberry, presumably referring to western or far northern parts of the range, since this species does not occur in heathlands, pinelands, or barrens in the eastern United States unless viburnums are present. Neither Wagner (2005) or the extensive compilation of Robinson et al. (2002) list Ericaceae as foodplants. Like many viburnum specialists, the larvae will not eat Viburnum acerifolium (Joseph R. Garris, observations in New Jersey). They probably do eat nearly all other native species though. Viburnums they are known to use include V. dentatum, lentago, nudum (including cassinoides), opulus (Robinson et al., 2002), and prunifolium. The last is regularly used in New Jersey (J.R. Garris) and may be a major foodplant on the Piedmont. The absence of this moth in most of the western United States probably reflects a lack of suitable viburnums. Adults visit a vast array of flowers, native and ornamental, often pink or purple ones. Garden phlox and Buddleia are favorites in summer as are certain cultivars of lilacs in spring. Sheep laurel (Kalmia) and wild azaleas are among native plants used in spring.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Hummingbird moths have a proboscis used to suck nectar from flowers. They feed from a variety of flowers, including honeysuckle, beebalm, lilac, snowberry and cranberry. They hover above the flowers and are often mistaken for hummingbirds. Their caterpillars feed on a variety of hosts, including honeysuckle, snowberry, hawthorns, cherries and plums. (Nicholson, 1999)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Flowering Plants Visited by Hemaris thysbe in Illinois

Hemaris thysbe Fabricius: Sphingidae, Lepidoptera
(observations are from Robertson, Reed, Hilty, Clinebell, Smith & Snow, Hapeman, Stoutamire, Guignard, Macior, and Luer; this moth is the Hummingbird Clearwing)

Asteraceae: Cirsium altissimum sn (Rb), Cirsium discolor sn (Rb), Echinacea pallida sn (Rb); Boraginaceae: Mertensia virginica sn (Rb); Caprifoliaceae: Viburnum prunifolium sn (Rb); Fabaceae: Orbexilum onobrychis sn (Rb); Geraniaceae: Geranium maculatum sn (Rb); Lamiaceae: Monarda fistulosa sn (Rb, Re, H, Cl); Orchidaceae: Platanthera blephariglottis sn (SS), Platanthera lacera sn (Lu), Platanthera peramoena sn fq (Hpm), Platanthera psychodes sn (Stm, Gu); Polemoniaceae: Phlox divaricata laphamii sn (Rb), Polemonium reptans sn (Rb); Ranunculaceae: Delphinium tricorne sn np (Mc)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

See Hemaris diffinis. Because in most of its range H. thysbe is associated with viburnums in more or less wooded places it is probably less likely to be a pollinator of rare plants of prairies and other open habitats than is H. diffinis. Nevertheless, both species are often among the most common hawk moths in rural parts of eastern states, and thus are potentially important pollinators of sphingophilous flowers. Probably even more so than with H. diffinis, proximity of breeding habitat could limit the availability of H. thysbe as a pollinator. Since both species are common overall, interest in them by conservation biologists is most likely to be in the context of pollination services.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Adults are on the wing late May - July.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: In Canada and the northern border states, there is one generation of adults in early summer. In most of the US portion of the range there are two or three broods. Adults occur from late March or sometime in April though August or September from about Missouri and New Jersey southward. As with all North American Sphingidae, this one overwinters as a pupa. Pupae are in a cocoon on the ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

The Hummingbird Clearwing is most often encountered during the day while nectaring at flowers. Unlike the Snowberry Clearwing, it is frequents open woodlands throughout much of the Boreal Forest region. It rarely alights, and the wingbeat is so rapid the wings are a blur, and thus it greatly resembles it's namesake, the hummingbird.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

During winter, the larvae burrow in the soil and overwinter as hard-shelled, brown pupae. In May or June, hummingbird moths emerge from the pupae. They then deposit spherical green eggs on the undersides of leaves (usually of host plants). A week later, the larvae hatch and feed on fruit and leaves. Four weeks later, they are fully developed. Pupation occurs in the soil, and adults emerge 2 to 4 weeks later to lay a second generation of eggs. (Lawrence, 1999)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Hemaris thysbe

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hemaris thysbe

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACTTTATACTTTATTTTCGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCAGAATTAGGTAACCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTAACAGCCCATGCATTTATTATAATTTTCTTCATAGTTATACCTATTATAATTGGTGGATTTGGAAACTGACTTGTACCTTTAATATTAGGTGCACCTGATATGGCATTCCCCCGAATAAATAATATGAGATTTTGACTTCTTCCACCTTCTTTAACCCTTCTTATTTCTAGAAGTATCGTTGAAAATGGTGCTGGTACTGGATGAACAGTTTACCCCCCTTTATCAGCAAATATCGCTCATAGAGGAAGATCAGTAGATTTAGCAATTTTTTCTCTACACTTAGCTGGTATTTCCTCAATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGAATCAACAATTTATCATTTGATCAAATACCTTTATTTGTATGAGCTGTTGGAATTACAGCATTTTTATTACTACTATCTTTACCAGTATTAGCAGGAGCTATTACTATACTTCTTACAGATCGAAATTTAAATACATCATTTTTTGATCCGGCTGGAGGAGGAGATCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

No concerns.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Huge range, occurs in many habitat types, a familiar species in many eastern U.S. and Canadian gardens.

Intrinsic Vulnerability: Not intrinsically vulnerable

Environmental Specificity: Moderate. Generalist or community with some key requirements scarce.

Comments: This species is probably restricted to places where native viburnums (but not V. acerifolium) grow in most of the range. Most records for other foodplants seem to be errors, in some cases due to confusing common names of shrubs. However, a number of the viburnums used by this species are quite common.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is not currently considered threatened on the state, federal, or global level.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Global Long Term Trend: Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: There are no known pervasive threats, but several threats can be substantial at a more local level.

The net effect of residential development is usually strongly negative. While adults are common in, and obviously benefit from, flower gardens, cultivated areas seldom provide much larval foodplant or pupation habitat, and in wooded areas these and other understory are generally destoyed even if trees are left.

Excessive browsing of viburnums by deer is a serious threat at a local scale since these foodplants can be killed outright, but it is unclear how widely this is really a concern, especially where tall, even semi-arboreal species like Viburnum prunifolium or V. lentago are abundant.

Herbicides and invasive plants are of concern because they affect native viburnums and other larval foodplants.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Many (13-40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Larvae of the closely related sphinx moth, called hornworms, are pests to tobacco and tomato plants as they oftentimes feed on them.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Hummingbird moths have little or no economic importance to humans. They are pollinators of some flowers, including the dune primrose. (Nicholson, 1999)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Stewardship Overview: Management would be unlikely unless in the context of local pollinators for a sphingophilous plant, such as some orchids. Such shortages seem unlikely except in intensively agricultural regions. Presumably the most productive approach for enhancement would be increasing availability of locally suitable foodplants, i.e. certain viburnums in most of the US part of the range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hemaris thysbe

Hemaris thysbe, commonly known as the Hummingbird Clearwing, is a moth of the Sphingidae (hawkmoth) family. Coloration varies between individuals, but typically the moth is olive green and burgundy on its back, and white or yellow and burgundy on the underside. Its wings are transparent with a reddish brown border. It has light colored legs, which combined with the lack of striping on the underside is diagnostic. Beating its wings rapidly, H. thysbe hovers to collect nectar from a variety of flowers. The combination of its appearance and its behavior commonly leads to it being confused with a hummingbird or bumblebee.

Hemaris thysbe is found in a large portion of the United States, with a range extending from Alaska to Oregon in the west and from Maine to Florida in the east. It is a migratory species and is most common in the eastern United States. H. thysbe was two broods a year in the southern portion of its range, but only one in the north. As a caterpillar, it feeds on honeysuckle and several types of fruit trees.

Due to the variable appearance of H. thysbe, it has often been mistakenly described as multiple distinct species. It was first identified by Johan Christian Fabricius in 1775. The moth is not endangered and has minimal economic impact upon humans.

Description[edit]

The body of an adult Hemaris thysbe moth is spindle shaped, and is largely covered by a thick coat of fur.[1][2] There is significant variation in coloration between individuals. Typically, the back side of moth is olive to golden-olive on the thorax and burgundy to black with light olive to dark golden patches on the abdomen. The underside of the moth is white to yellow on the thorax and burgundy to black on the abdomen.[3] When it first hatches, the wings of H. thysbe are dark red to black. As it begins to fly, scales fall off leaving a mostly clear wing with reddish brown borders and veins.[1] The width and shape of the border as well as the patterning of the veins vary between individuals.[4] The moth beats its wings quite rapidly and has a wingspan of 4 to 5.5 centimetres (1.6 to 2.2 in).[1][2] H. thysbe has light colored, often yellow legs.[3] In general, southern broods and individuals hatched later in the season are darker in color. Southern and eastern populations generally exhibit jagged wing borders, while northern and western ones are usually smooth.[4]

Hemaris thysbe extends its long proboscis to feed from a flower

The antennae of H. thysbe are thicker at their base and are curved at the ends. Unlike most moths, the species lacks hearing organs.[1] It has compound eyes and well-developed reproductive organs.[4][5] Hemaris thysbe can be distinguished from Hemaris gracilis and Hemaris diffinis by the lack of stripes on the underside of its thorax and by its pale legs.[3] (Legs are reddish in H. gracilis and black in H. diffinis.)[6] The H. thysbe caterpillar is yellowish green with bands of dark green and reddish brown to dark brown.[1] It has a granulose body with small, white spots and a white horn projecting from the its posterior.[4]

As a caterpillar, H. thysbe feeds on cherry trees, European cranberry bush, hawthorns, honeysuckle, and snowberry.[3] It burrows into the soil to overwinter as a brown, hard-shelled pupae. In the late spring, it emerges as an adult moth. H. thysbe lays green eggs on the underside of plants leaves which hatch in about a week.[1] Development takes four weeks after which the caterpillar spins a cocoon at ground level.[1][3] Two to four weeks later a moth emerges for a second breeding cycle before summer's end in southern climates.[1][6] In northern climates, H. thysbe has a single mating cycle per year.[6]

The mating and other behavioral habits of H. thysbe have not been well studied.[1] Adults are most active during the hottest parts of the day, but remain active until sunset.[7] H. thysbe collects nectar from a wide variety of flowers using a long (19–21 millimetres [0.75–0.83 in]) proboscis while hovering above the bloom.[5][7] It shows a preference for pink and purple flowers, moving rapidly from one flower to the next.[5] The moth is considered to be a hummingbird mimic and is frequently mistaken for the bird or for a bumblebee.[3]

Habitat and range[edit]

Hemaris thysbe lives in second-growth forest, in meadows, and is commonly found in cultivated gardens of suburbia.[1][3] H. thysbe is a migratory species, capable of traveling long distances.[1] In single brood regions, adults are found throughout the summer. In the south, adults are present from March to June and from August to October.[4]

H. thysbe is most abundant in the eastern United States, with a range from Florida to Maine.[1] Its range extends westward to Texas, the Great Plains, and into Manitoba, Saskatchewan and Alberta. On the west coast of North America, its range extends from Oregon to British Columbia, and into Alaska.[3] It has minimal economic impact to humans acting neither as a crop pollinator nor as a pest.[1] The moth does, however, pollinate several cultivated flowers, and is the primary pollinator for some species of orchid.[5] H. thysbe is not endangered or threatened.[1]

Taxonomic history[edit]

Hemaris thysbe hovers over a flower while feeding

Hemaris thysbe was first described by Johan Christian Fabricius in 1775 as Sesia thysbe in his Systema Entomologiae.[4] The specific name is likely a reference to Thisbe, half of a pair of ill-fated lovers in Ovid's Metamorphoses. The name thus associates the blood-stained scarf of Thisbe to the reddish brown coloration of the moth.[6]

Due to the variable coloration and wing patterning of H. thysbe, it, along with other members of Hermaris, were described as many different species during the 1800s. In 1971, entomologist Ronald Hodges examined the various forms in detail. He dissected a number of specimens representing the range of H. thysbe's coloration and geographic scope and found no differences in their reproductive organs. He thus concluded that the many variations represent a single species. Species collapsed into H. thysbe include:[4]

  • Sphinx pelasgus Cramer, 1780
  • Sesia cimbiciformis Stephens, 1828
  • Sesia ruficaudis Kirby, 1837
  • Sesia fuscicaudis Walker, 1856
  • Haemorrhagia buffaloensis Grote & Robinson, 1867
  • Haemorrhagia floridensis Grote & Robinson, 1867
  • Sesia uniformis Grote, 1868
  • Macroglossa etolus Boisduval, 1875
  • Macroglossa pyramus Boisduval, 1875

References[edit]

  1. ^ a b c d e f g h i j k l m n Katie Drury. "Hemaris thysbe". Animal Diversity Web. University of Michigan. Retrieved August 21, 2013. 
  2. ^ a b "Species Page - Hemaris thysbe". Entomology Collection. E.H. Strickland Entomological Museum (University of Alberta). Retrieved August 22, 2013. 
  3. ^ a b c d e f g h "Attributes of Hemaris thysbe". Butterflies and Moths of North America. Retrieved August 21, 2013. 
  4. ^ a b c d e f g Ronald W. Hodges (1971). The Moths of America, North of Mexico, Including Greenland. London: E.W. Classey Limited and R.B.D. Publications Inc. pp. 114–117. 
  5. ^ a b c d Charles L. Argue (2011). The Pollination Biology of North American Orchids: Volume 1. Springer. ISBN 1461405920. 
  6. ^ a b c d "Species Hemaris thysbe - Hummingbird Clearwing - Hodges". BugGuide. July 26, 2011. Retrieved August 22, 2013. 
  7. ^ a b RC Fleming (1970). "Food plants of some adult sphinx moths (Lepidoptera: Sphingidae)". Michigan Entomologist 3: 17–23. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!