Overview

Comprehensive Description

General Description

A medium-size (3.5-5 cm wingspan) day-flying moth with translucent wings with narrow dark margins and the veins lined with dark scales. The forewing apex and base are red-brown. Both the head and thorax are olive-brown, the basal half of the abdomen is black with steel-blue patches and the posterior half is yellow, tipped with black. The larger Hummingbird Clearwing has wider margins on the wings, and dark olive brown, not yellow, patches on the abdomen. The Slender Clearwing (H. gracilis) is restricted to the boreal forest region, and lacks scaling in the forewing cell. Although not yet confirmed for Alberta, the very similar H. senta should be watched for in the mountains. "Most of the diagnostic characters (for separating senta and diffinis) are trends but some are fairly good. In senta, the first two abdominal segments are black and the next three segments are yellow (dorsally), while in diffinis the tendency is for the first three segments to be black and the next two segments are yellow (dorsally). In senta, the ventrum of the abdomen is almost all yellow except the black anal tuft and the legs are yellow, while in diffinis the ventrum of the abdomen has significant black and the legs are black... in addition, there is a black stripe running across the thorax from the eyes to the abdomen" (J. Tuttle, pers. corr., September 2001).
D. Macaulay image
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

From the Atlantic coast to Vancouver Island, mainly south of the boreal forest but widespread in the mountains, south to Texas and northern Mexico. In Alberta, it occurs in open meadows north into the southern edge of the Boreal forest, but is most common in the foothills.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Tuttle's (2007) map shows this species as present in portions of or all of the lower 48 US states, but absent from most of Florida and Texas, and also the coastal southern peninsula of Alaska and almost half of Canada including all of the mainland provinces except Labrador, but absent from most of the Yukon and Northwest Territories and all of the arctic. However, many of the western records, including those from British Columbia and all US records from west of central Colorado, are actually Hemaris thetis according to Schmidt (2009), who suggests that H. diffinis is not found widely, if at all, west of the continental divide. His map, based on actual specimen data, shows H. diffinis and H. thetis as overlapping in central and southwestern Alberta and in central Colorado, and H. diffinis (but not H. thetis) also in the Peace River grasslands of northwestern Alberta, with only H. thetis farther west, e.g. British Columbia and the three west coastal US states, presumably including Alaska. Schmidt has few records for Idaho, Nevada, Utah and, Arizona, but all of them are H. thetis. The exact western limits of H. diffinis are thus unclear in some portions of the range, e.g. through Wyoming and Montana, but generally it occurs east of the range shown by Tuttle for H. "senta". Tuttle's H. senta is now included in H. thetis (Schmidt, 2009) but so are western populations Tuttle mapped as H. diffinis.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Ecology

Habitat

Open areas including meadows, clearings, roadsides and woodland edges.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Adults are most often seen at flowers in gardens. While they usually seem to oviposit in fairly open habitats, they will move into forests to oviposit on ground cover Japanese honeysuckle at least in spring before canopy closure. Larvae can often be found on honeysuckles in edges or thickets. Westward, snowberry often occurs in prairies or savannas as do the moths. This seems to be fundamentally a species of prairies, savannas, fields, meadows, and edges, that has adapted to suburban and other disturbed areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

No Alberta data; elsewhere the reported larval hosts are Snowberry (Symphoricarpos occidentalis, S. racemosus, and S. mollis), and Honeysuckle (Lonicera nitida). Adults visit many species of flowers for nectar.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: The usual larval foodplants are mostly Caprifoliaceae, native foodplants include Diervilla lonicera, species of Lonicera, and probably Symphoricarpos (Tuttle, 2009). However, at least some of those for Symphoricarpos actually refer to H. thetis (Schmidt, 2009). Some native Apocynaceae, especially Amsonia species are also used (Robinson et al., 2002, Wagner, 2005), and Tietz (1952) and others report Apocynum. Invasive exotic honeysuckles have increasingly become the primary foodplants in many places in the East. This may well be the only caterpillar that regularly uses the highly toxic, invasive Japanese honeysuckle (Lonicera japonica) although a few others have been reported from it. Ovipositions and larvae are frequently seen on that vine in south Jersey where originally H. diffinis was apparently rare, if present at all. Ground cover vines or those in low bushes are usually selected. Species identifications of exotic bush honeysuckles is difficult, but at least some of these also are used. Adults visit a wide array of flowers, but are perhaps most often seen at garden Buddleia. Earlier in the season they use azaleas, lilacs, and sheep laurel, among others.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Flowering Plants Visited by Hemaris diffinis in Illinois

Hemaris diffinis Boisduval: Sphingidae, Lepidoptera
(observations are from Robertson, Reed, Wiggam & Ferguson, Graenicher, Clinebell, Hapeman, Groman, Schoen, and Guignard; this moth is the Snowberry Clearwing)

Agavaceae: Manfreda virginica sn (Grm); Asclepiadaceae: Asclepias sullivanti [plab sn] (Rb); Caprifoliaceae: Diervilla lonicera sn (Sch), Lonicera reticulata sn (Gr), Lonicera tartarica sn np (Gr), Symphoricarpos occidentalis sn (Gr); Fabaceae: Trifolium pratense sn (Rb); Grossulariaceae: Ribes missouriense sn (Gr); Lamiaceae: Agastache foeniculum sn (Re), Monarda fistulosa sn (Rb, Re, Cl), Teucrium canadense sn (Rb); Orchidaceae: Platanthera peramoena sn (Hpm), Platanthera psychodes sn (Gu); Polemoniaceae: Phlox divaricata laphamii sn fq (WF); Verbenaceae: Verbena stricta sn (Rb, Re)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: Essentially undefineable in much of range, a common landscape species using a great variety of habitats, the adults especially partial to gardens.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

100,000 - 1,000,000 individuals

Comments: No actual estimate but this is a common moth over much of a large continent, so one million adults per generation seems very conservative.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

These moths are potential pollinators of deep flowers such as Platanthera orchids which require the moth's head to get inside in order to reach the nectar, or others with small sticky pollen that adheres to the long proboscis (see Tuttle, 2009, fig.9). Since this and H. thysbe are among the most common Sphingidae in much of the eastern US, they may be important pollinators of sphingophilous flowers in general. It is not known how far adults routinely disperse in search of nectar, but this could be a very important factor in their availability as pollinators in portions of their range where the foodplants are more or less restricted to fragments of native habitats, such as patches of prairie in extensively agricultural regions.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Adults have been collected in Alberta April through June, with the peak flight in late May and June.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: In most of the range there are two or more annual generations with adults from about mid or late April to mid September, probably three broods, with a few stragglers later, in southern New Jersey (D. Schweitzer), late April to October in Louisiana (Tuttle, 2009). About May to August in Maine and much of Canada. Presumably only one brood in northern Canada, but dates from May to early early August suggest two in southern Canada. Like all North American Sphingidae, pupae overwinter, in this genus in a cocoon at the soil surface.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

The Snowberry Clearwing is diurnal and is most often encountered nectaring at spring flowers, including dandelions and lilacs. They are more of a grassland and open meadow species than the Hummingbird and Slender Clearwings. Snowberry Clearwings are rarely encountered when not on the wing, they look more like bees than moths. When the adults first emerge from the pupae, the wings are completely scaled, but most scales are loosely attached and fall off during the initial flight, leaving much of the wing translucent. There appears to be a single brood each year.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Hemaris diffinis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 49
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Hemaris diffinis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACTTTATACTTTATTTTTGGAATCTGAGCAGGAATAGTAGGAACTTCATTAAGATTACTAATTCGAGCAGAATTAGGTAACCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTAACAGCTCATGCATTTATTATAATTTTTTTCATGGTTATACCTATTATAATTGGTGGATTTGGAAATTGACTTGTACCTTTAATATTAGGTGCACCTGATATAGCATTCCCTCGAATAAATAATATAAGATTTTGACTTCTTCCCCCATCATTAACCCTTCTTATTTCTAGAAGTATTGTTGAAAATGGAGCTGGTACTGGATGAACAGTTTACCCCCCTTTATCAGCTAACATTGCACATAGAGGAAGATCAGTAGATCTAGCAATTTTTTCCCTCCACTTAGCTGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACCACAATTATTAATATACGAATTAATAATTTATCATTTGATCAAATACCTCTATTTGTATGAGCTGTTGGAATCACAGCATTTTTATTGCTTTTATCCTTACCAGTATTAGCAGGAGCTATTACCATACTTCTTACTGATCGAAACTTAAATACATCATTTTTTGATCCTGCAGGTGGGGGAGATCCTATTTTATATCAACATTTATTTNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

No concerns.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: This was historically fairly common using snowberry and native honeysuckles. It is much more common now eastward where it has benefited greatly from exotic introduced honeysuckles, such as Lonicera japonica, which are now the main foodplants in much of the Northeast. Widespread throughout the USA and temperate Canada east of the Continental Divide.

Intrinsic Vulnerability: Not intrinsically vulnerable

Environmental Specificity: Broad. Generalist or community with all key requirements common.

Comments: Adaptable to a wide range of habitats including suburbia and old fields as well as more natural ones.

Other Considerations: This species has benefited substantially from some invasive species of Lonicera, perhaps especially Japanese honeysuckle, which are very suitable foodplants and have allowed this moth to increase substantially in parts of the east where native foodplants are naturally scarce or have been severely impacted by deer. In much of the East though native honeysuckles are so reduced that H. diffinis is now almost entirely dependent on exotics.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Increase of 10 to >25%

Global Long Term Trend: Increase of >25%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Relatively unthreatened except locally by development and extreme herbivory by deer, and in heavily agricultural regions extensive herbiciding of fence rows etc. eliminates habitat for this and many other pollinators. The same is true in states (e.g. Pennsylvania) where herbicides are widely used along highways and roadsides. Overall this species probably benefits from disturbances that favor exotic honeysuckles and probably also from flower gardens.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Several to very many (4 to >40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Stewardship Overview: Seee element management group. Management would not be likely eastward.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Hemaris diffinis

The Snowberry Clearwing (Hemaris diffinis) is a moth of the order Lepidoptera, family Sphingidae.

Adults[edit]

It is about 32–51 millimetres (1.25–2 in). The moth's abdomen has yellow and black segments much like those of the bumblebee, for whom it might be mistaken due to its color and flight pattern similarities. The moth's wings lack the large amount of scales found in most other lepidopterans, particularly in the centralized regions, making them appear clear. It loses the scales on its wings early after the pupa stage by its highly active flight tendencies. It flies during the daylight much like the other hummingbird moths, but it may also continue flight into the evening, particularly if it has found a good source of nectar.

Distribution[edit]

The moth is found from the Northwest Territories, British Columbia and in southern Ontario in Canada. In the United States this species has been located in southern California and Baja California Norte, east through most of the United States to Maine and Florida.

Food Plants[edit]

The larvae feed on plants including honeysuckle, viburnum, hawthorn, snowberry, cherry, and plum.

Gallery[edit]

References[edit]

  1. ^ "CATE Creating a Taxonomic eScience - Sphingidae". Cate-sphingidae.org. Retrieved 2011-10-19. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: This circumscription follows Schmidt (2009) who documents that Hemaris thetis is a a separate, western species, that include both populations Tuttle (2007) both western populations Tuttle (2007) included in H. diffinis as well as all those he separated out as H. senta. H. diffinis occurs west only to about the Continental Divide, being replaced by H. thetis to the west.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!