Ecology

Habitat

Depth range based on 6586 specimens in 46 taxa.
Water temperature and chemistry ranges based on 2668 samples.

Environmental ranges
  Depth range (m): -99 - 80000
  Temperature range (°C): -2.013 - 27.749
  Nitrate (umol/L): 0.006 - 35.099
  Salinity (PPS): 18.292 - 40.679
  Oxygen (ml/l): 1.615 - 8.615
  Phosphate (umol/l): 0.038 - 2.386
  Silicate (umol/l): 0.756 - 137.447

Graphical representation

Depth range (m): -99 - 80000

Temperature range (°C): -2.013 - 27.749

Nitrate (umol/L): 0.006 - 35.099

Salinity (PPS): 18.292 - 40.679

Oxygen (ml/l): 1.615 - 8.615

Phosphate (umol/l): 0.038 - 2.386

Silicate (umol/l): 0.756 - 137.447
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:196Public Records:128
Specimens with Sequences:174Public Species:15
Specimens with Barcodes:174Public BINs:16
Species:21         
Species With Barcodes:19         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phyllodoce cf. madeirensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Phyllodoce groenlandica CMC02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNTACTTTATATATAATTTTTGGAATTTGGTCTGGTCTTCTTGGTACCTCGATAAGAATATTGATTCGAGCTGAGTTAGGGCAGCCAGGATCTTTGTTAGGAAGCGATCAGTTATATAACACAATTGTAACTGCGCATGCTTTTTTAATGATTTTTTTTCTAGTGATACCTGTTATAATTGGCGGTTTTGGTAATTGATTAGTTCCTTTAATACTTGGTGCTCCTGATATAGCTTTTCCTCGTTTAAATAATATAAGGTTTTGGTTGTTACCTCCTTCTTTAATTATACTCTTAGGGTCTGCTGCAGTGGAGCAGGGTGCTGGAACTGGTTGAACAGTTTACCCTCCCTTATCTAGAAATGTTGCTCATTCAGGGCCTTCTGTGGATTTGGCTATTTTTTCTTTACATTTAGCAGGGGTATCTTCTATTCTTGCGTCAATTAATTTTATTACTACTGCAATAAATATGCGTTCTAGAGGTCTTCGGTTGGAGCGTGTACCTTTATTCGTTTGGTCTGTGGCTATTACTGCTTTACTTCTTTTATTATCATTACCTGTTCTTGCGGGGGCTATTACAATGTTATTAACTGATCGGAATTTAAATACTTCTTTTTTTGATCCTGCTGGAGGAGGGGATCCTATTTTGTATCAACATCTTTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phyllodoce groenlandica CMC02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Phyllodoce groenlandica CMC01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 41 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNTACTTTATATATAATTTTTGGGATTTGGTCTGGACTTCTCGGTACTTCTATAAGAATGTTGATTCGGGCTGAGTTAGGGCAGCCTGGGTCTTTATTAGGAAGGGATCAGTTGTATAATACAATTGTTACTGCACATGCTTTTTTAATAATTTTTTTTTTAGTTATGCCAGTAATAATTGGTGGTTTTGGAAACTGGCTAGTTCCTTTAATACTTGGAGCACCAGATATGGCTTTCCCTCGTTTAAATAATATAAGATTTTGGTTATTGCCCCCTTCTCTTATTATACTCTTAGGGTCTGCAGCAGTTGAGCAAGGGGCTGGTACAGGTTGAACAGTTTATCCTCCTTTATCTAGGAATGTTGCTCATTCAGGGCCTTCAGTGGATTTAGCAATTTTTTCTTTACATTTAGCTGGTGTATCTTCAATTTTAGCGTCAATTAATTTTATTACAACAGCAATAAATATGCGTTCAAGGGGTTTACGGTTAGAGCGGGTTCCTTTATTTGTATGGTCAGTAGCTATTACTGCTTTACTTCTTTTGTTATCTTTGCCTGTTCTTGCAGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACATCTTTTTTTGATCCTGCTGGGGGAGGTGATCCTATTTTATATCAACATCTTTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phyllodoce groenlandica CMC01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 53
Specimens with Barcodes: 53
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Phyllodoce

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!