Overview

Distribution

Phyllodoce mucosa-maculata: In the 1976-1986 period Phyllodoce mucosa/maculata was widely distributed in the entire near-coastal zone and reached a maximum density of 70 ind./m2. The species showed a similar distribution pattern in the 1994-2001 period. However, P. mucosa/maculata was absent near the eastern coastal zone and higher densities (up to 1,500 ind./m2) were reached in the latter period.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Description

Phyllodoce mucosa-maculata: Free-living, very active bristle worm with parapodia whose dorsal cirri are remarkably large and leaf-like (resembling paddles). Heart-shaped head with two eyes and four antennae. Eversible unarmed proboscis covered with rows of large and/or small papillae. Colour ranges from white to yellowish with transverse dark brown bands or patches.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Phyllodoce mucosa-maculata is found in sediments with a wide variety of grain sizes (maximum 500 µm), but displays a preference for sediments with a median grain size between 100 and 300 µm (relative occurrence > 30%). A similar pattern is observed with regard to the mud content preference: Phyllodoce mucosa-maculata is found in sediments with strongly varying mud contents, but prefers sediments with a mud content up to 40% (relative occurrence: minimum 40%).
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 6586 specimens in 46 taxa.
Water temperature and chemistry ranges based on 2668 samples.

Environmental ranges
  Depth range (m): -99 - 80000
  Temperature range (°C): -2.013 - 27.749
  Nitrate (umol/L): 0.006 - 35.099
  Salinity (PPS): 18.292 - 40.679
  Oxygen (ml/l): 1.615 - 8.615
  Phosphate (umol/l): 0.038 - 2.386
  Silicate (umol/l): 0.756 - 137.447

Graphical representation

Depth range (m): -99 - 80000

Temperature range (°C): -2.013 - 27.749

Nitrate (umol/L): 0.006 - 35.099

Salinity (PPS): 18.292 - 40.679

Oxygen (ml/l): 1.615 - 8.615

Phosphate (umol/l): 0.038 - 2.386

Silicate (umol/l): 0.756 - 137.447
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Evolution

classification

M'Harzi (1999) placed this genus under the family Phyllodocidae Williams, 1852
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:202
Specimens with Sequences:201
Specimens with Barcodes:194
Species:24
Species With Barcodes:24
Public Records:130
Public Species:18
Public BINs:18
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phyllodoce cf. madeirensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Phyllodoce groenlandica CMC02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNTACTTTATATATAATTTTTGGAATTTGGTCTGGTCTTCTTGGTACCTCGATAAGAATATTGATTCGAGCTGAGTTAGGGCAGCCAGGATCTTTGTTAGGAAGCGATCAGTTATATAACACAATTGTAACTGCGCATGCTTTTTTAATGATTTTTTTTCTAGTGATACCTGTTATAATTGGCGGTTTTGGTAATTGATTAGTTCCTTTAATACTTGGTGCTCCTGATATAGCTTTTCCTCGTTTAAATAATATAAGGTTTTGGTTGTTACCTCCTTCTTTAATTATACTCTTAGGGTCTGCTGCAGTGGAGCAGGGTGCTGGAACTGGTTGAACAGTTTACCCTCCCTTATCTAGAAATGTTGCTCATTCAGGGCCTTCTGTGGATTTGGCTATTTTTTCTTTACATTTAGCAGGGGTATCTTCTATTCTTGCGTCAATTAATTTTATTACTACTGCAATAAATATGCGTTCTAGAGGTCTTCGGTTGGAGCGTGTACCTTTATTCGTTTGGTCTGTGGCTATTACTGCTTTACTTCTTTTATTATCATTACCTGTTCTTGCGGGGGCTATTACAATGTTATTAACTGATCGGAATTTAAATACTTCTTTTTTTGATCCTGCTGGAGGAGGGGATCCTATTTTGTATCAACATCTTTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phyllodoce groenlandica CMC02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Phyllodoce groenlandica CMC01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 41 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNTACTTTATATATAATTTTTGGGATTTGGTCTGGACTTCTCGGTACTTCTATAAGAATGTTGATTCGGGCTGAGTTAGGGCAGCCTGGGTCTTTATTAGGAAGGGATCAGTTGTATAATACAATTGTTACTGCACATGCTTTTTTAATAATTTTTTTTTTAGTTATGCCAGTAATAATTGGTGGTTTTGGAAACTGGCTAGTTCCTTTAATACTTGGAGCACCAGATATGGCTTTCCCTCGTTTAAATAATATAAGATTTTGGTTATTGCCCCCTTCTCTTATTATACTCTTAGGGTCTGCAGCAGTTGAGCAAGGGGCTGGTACAGGTTGAACAGTTTATCCTCCTTTATCTAGGAATGTTGCTCATTCAGGGCCTTCAGTGGATTTAGCAATTTTTTCTTTACATTTAGCTGGTGTATCTTCAATTTTAGCGTCAATTAATTTTATTACAACAGCAATAAATATGCGTTCAAGGGGTTTACGGTTAGAGCGGGTTCCTTTATTTGTATGGTCAGTAGCTATTACTGCTTTACTTCTTTTGTTATCTTTGCCTGTTCTTGCAGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACATCTTTTTTTGATCCTGCTGGGGGAGGTGATCCTATTTTATATCAACATCTTTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phyllodoce groenlandica CMC01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 53
Specimens with Barcodes: 53
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Phyllodoce (worm)

Phyllodoce is a genus of polychaete worms. It contains ca. 120 species.[1] Prostomium bears eyes, two pairs of antennae and a pair of large retractile nuchal organs.[2] Eversible proboscis is clearly divided into two parts.[2]

References[edit]

  1. ^ World Register of Marine Species link: Phyllodoce (+species list)
  2. ^ a b Pleijel, Fredrik (1991). "Phylogeny and classification of the Phyllodocidae (Polychaeta)". Zoologica Scripta 20 (3): 225–261. doi:10.1111/j.1463-6409.1991.tb00289.x. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!