Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Ragworms are predator worms with strong jaws; a large ragworm can produce quite a bite! They have lots of small legs, which explains why they are also called marine centipedes in Dutch. They emerge out of the sea bottom to mate in the spring. Deep-sea fishermen like to use ragworms for bait because fish like to bite into them. However, these worms are more difficult to dig up out of the mudflats, making them more expensive than lugworms. That is why ragworms are cultivated. There are various kinds of ragworms. The king rag can grow as long as 40 centimeters. The estuary ragworm grows to 20 centimeters.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

 (after Bakken and Wilson 2005). Prostomium with entire anterior margin, one pair of antennae, one pair of biarticulated palps with conical palpostyles, four pairs of tentacular cirri with distinct cirrophores. Eyes present or absent. One apodous anterior segment, greater than length of chaetiger 1. Maxillary ring of pharynx, conical paragnaths: Areas I−III, present or absent; IV, present, smooth bar-like paragnaths present or absent. Oral ring: conical paragnaths present or absent. Dorsal notopodial ligule similar in size in anterior and posterior chaetigers or markedly reduced on posterior chaetigers. Prechaetal notopodial lobe present or absent, smaller than dorsal notopodial ligule on anterior chaetigers, usually reduced or absent posteriorly. Dorsal cirrus basally attached to dorsal notopodial ligule throughout all chaetigers, lacking basal cirrophore. Neuropodial postchaetal lobe absent. Notoaciculae absent from chaetigers 1 and 2. Notochaetae: homogomph spinigers, homogomph falcigers present. Neurochaetae, superior fascicle: homogomph spinigers present, heterogomph falcigers on anterior chaetigers present or absent, on posterior chaetigers present. Neurochaetae, inferior fascicle: heterogomph spinigers present or absent, heterogomph falcigers present or absent. 
Creative Commons Attribution 3.0 (CC BY 3.0)

© Teresa Darbyshire

Source: ZooKeys

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Size under dissecting microscope:    ~300-450µm, depending on number of chaetigers
  Size under compound microscope:  same

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Morphology

 Nereidid larvae are usually found at the 3-4 chaetiger stage in our samples. They have visible antennae and tentacular cirri projecting from the sides of the head, as well as a pair of anal cirri. The parapodia are well-developed and there are usually dark or reddish spots visible at the bases of two adjacent pairs, as shown above. This is presumably Nereis sandersi Blake, the only nereidid at 9°N.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Nereis (Nereis) eakini Hartman
Catalog Number: USNM 20203
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): R. Eakin
Year Collected: 1934
Locality: Monterey Bay, Pacific Grove, California, United States, North Pacific Ocean
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Holotype for Nereis (Nereis) neonigripes Hartman
Catalog Number: USNM 20201
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Locality: Pacific Grove, California, United States, North Pacific Ocean
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Nereis (Nereis) eucapitis Hartman
Catalog Number: USNM 20198
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): O. Hartman
Year Collected: 1934
Locality: Monterey Bay, Moss Beach, California, United States, North Pacific Ocean
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Can be confused with:

These larvae are most likely to be confused with Ophryotrocha sp., which is superficially similar, but lacks the tentacular cirri and the dark spots on the parapodia. Nereis has larger parapodia with longer chaetae, but lacks the obvious jaw apparatus that Ophryotrocha has.     

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 1922 - 1922
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0.1 - 0.1
  Temperature range (°C): 10.151 - 10.151
  Nitrate (umol/L): 6.725 - 6.725
  Salinity (PPS): 31.893 - 31.893
  Oxygen (ml/l): 6.561 - 6.561
  Phosphate (umol/l): 0.943 - 0.943
  Silicate (umol/l): 15.658 - 15.658
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 16 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.025 - 0.05

Graphical representation

Depth range (m): 0.025 - 0.05
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 66 - 66
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4819 specimens in 68 taxa.
Water temperature and chemistry ranges based on 1558 samples.

Environmental ranges
  Depth range (m): -1.55 - 25000
  Temperature range (°C): -1.602 - 27.678
  Nitrate (umol/L): 0.090 - 44.610
  Salinity (PPS): 18.622 - 39.023
  Oxygen (ml/l): 0.482 - 8.585
  Phosphate (umol/l): 0.038 - 3.312
  Silicate (umol/l): 0.756 - 176.733

Graphical representation

Depth range (m): -1.55 - 25000

Temperature range (°C): -1.602 - 27.678

Nitrate (umol/L): 0.090 - 44.610

Salinity (PPS): 18.622 - 39.023

Oxygen (ml/l): 0.482 - 8.585

Phosphate (umol/l): 0.038 - 3.312

Silicate (umol/l): 0.756 - 176.733
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
translation missing: en.license_cc_by_4_0

© WoRMS Editorial Board

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4819 specimens in 68 taxa.
Water temperature and chemistry ranges based on 1558 samples.

Environmental ranges
  Depth range (m): -1.55 - 25000
  Temperature range (°C): -1.602 - 27.678
  Nitrate (umol/L): 0.090 - 44.610
  Salinity (PPS): 18.622 - 39.023
  Oxygen (ml/l): 0.482 - 8.585
  Phosphate (umol/l): 0.038 - 3.312
  Silicate (umol/l): 0.756 - 176.733

Graphical representation

Depth range (m): -1.55 - 25000

Temperature range (°C): -1.602 - 27.678

Nitrate (umol/L): 0.090 - 44.610

Salinity (PPS): 18.622 - 39.023

Oxygen (ml/l): 0.482 - 8.585

Phosphate (umol/l): 0.038 - 3.312

Silicate (umol/l): 0.756 - 176.733
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Nereis is prey of:
Clevelandia
Pleuronectiformes
Cerebratulus
Limulus
Pagurus
Cancer
Myoxocephalus
Tautogolabrus
Pseudopleuronectes
Other suspension feeders
Mya arenaria
Crassostrea virginica
Polychaeta
Nereis
meiofauna
Callinectes sapidus
Alosa pseudoharengus
Alosa chrysochloris
Anchoa mitchilli
Brevoortia tyrannus
Alosa sapidissima
Micropogonius undulatus
Trinectes maculatus
Morone americana
Arius felis
Pomatomus saltatrix

Based on studies in:
USA: California (Estuarine, Intertidal, Littoral)
USA: Massachusetts, Cape Ann (Littoral, Mudflat)
USA: Maryland, Chesapeake Bay (Estuarine)

This list may not be complete but is based on published studies.
  • Baird D, Ulanowicz RE (1989) The seasonal dynamics of the Chesapeake Bay ecosystem. Ecol Monogr 59:329–364
  • G. E. MacGinitie, Ecological aspects of a California marine estuary, Am. Midland Nat. 16(5):629-765, from p. 652 (1935).
  • R. W. Dexter, The marine communities of a tidal inlet at Cape Ann, Massachusetts: a study in bio-ecology, Ecol. Monogr. 17:263-294, from p. 284 (1947).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Nereis preys on:
Lumbrinereis
Notomastus
Clymenella
Solemya
Ensis
Macoma
Mya
phytoplankton
microzooplankton
zooplankton
Ctenophora
Chrysaora quinquecirrha
Other suspension feeders
Mya arenaria
Polychaeta
Nereis
meiofauna
Crustacea
Callinectes sapidus

Based on studies in:
USA: California (Estuarine, Intertidal, Littoral)
USA: Massachusetts, Cape Ann (Littoral, Mudflat)
USA: Maryland, Chesapeake Bay (Estuarine)

This list may not be complete but is based on published studies.
  • Baird D, Ulanowicz RE (1989) The seasonal dynamics of the Chesapeake Bay ecosystem. Ecol Monogr 59:329–364
  • G. E. MacGinitie, Ecological aspects of a California marine estuary, Am. Midland Nat. 16(5):629-765, from p. 652 (1935).
  • R. W. Dexter, The marine communities of a tidal inlet at Cape Ann, Massachusetts: a study in bio-ecology, Ecol. Monogr. 17:263-294, from p. 284 (1947).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:339
Specimens with Sequences:304
Specimens with Barcodes:270
Species:24
Species With Barcodes:21
Public Records:137
Public Species:15
Public BINs:22
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Nereis sp. CMC02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNTTTTATTTTCGGCATGTGGTCAGGTTTACTGGGGACATCAATAAGACTCCTTATTCGGGCAGAACTGGGACAGCCCGGGTCTCTTCTAGGAAGAGATCAACTATATAACACAATTGTTACAGCCCATGCATTTCTTATAATTTTTTTCCTCGTAATACCAGTAATAATTGGGGGATTTGGTAACTGACTAGTACCCCTAATACTAGGTGCCCCAGATATAGCTTTTCCCCGATTAAATAATATAAGTTTTTGACTATTACCCCCCTCTTTAACACTTTTACTATCTAGTGCCGCAGTTGAAAAAGGAGTTGGAACAGGATGAACAGTCTATCCTCCGTTATCCAGTAATATTGCCCATGCAGGCGCATCAGTTGATTTAGCAATTTTCTCTTTACATTTAGCAGGAGTGTCTTCCATTATAGGAGCATTAAATTTTATTACTACAGTTATTAATATACGCTCAAGGGGTCTACGATTAGAACGGGTTTCTTTATTTGTATGATCTGTTGTAATTACAGCTGTCCTACTTCTTTTAAGACTACCTGTTTTAGCAGGAGCTATTACAATATTACTCACCGACCGTAATTTAAATACCGCTTTTTTCGATCCAGCCGGCGGGGGGGACCCAGTTCTATATCAACATTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Nereis sp. CMC02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Nereis sp. CMC01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGCACTTTATATTTTATCTTTGGCATATGATCGGGATTACTAGGAACATCTATAAGACTCTTAATCCGAGCAGAACTAGGTCAACCCGGGTCATTACTAGGCAGAGATCAATTATATAATACCATCGTCACAGCACATGCATTCCTGATAATCTTCTTTCTTGTAATACCCGTAATAATCGGGGGATTCGGCAACTGATTAGTACCACTAATATTAGGAGCCCCAGATATAGCCTTTCCACGACTAAATAATATAAGATTCTGACTCCTACCCCCTTCACTTACACTACTACTATCAAGCGCGGCCGTAGAAAAAGGAGCAGGAACAGGATGAACAGTCTACCCCCCTCTAGCAAGGAATATTGCTCACGCAGGACCCTCAGTAGACCTCGCAATTTTCTCTCTTCATTTAGCAGGGGCATCATCAATTATAGGAGCACTAAATTTCATTACAACAGTCATCAATATACGGTCAAAGGGACTTCGCCTAGAACGAGTTCCATTATTCGTATGATCAGTAGTAATTACAGCTGTACTACTATTACTAAGATTACCTGTGTTAGCAGGAGCAATCACAATATTACTAACAGACCGTAACCTTAACACAGCATTCTTTGACCCAGCAGGTGGGGGTGACCCTATTCTATATCAACACCTCTTCN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Nereis sp. CMC01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Nereis sp. 1 DH1

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTAATTCGTGCCGAACTTGGTCAACCAGGATCACTGCTTGGCAGA---GATCAACTTTATAACACCATCGTAACAGCCCATGCATTCCTAATAATCTTTTTCTTAGTAATGCCTGTAATAATTGGAGGATTTGGCAACTGGCTTATCCCACTAATG---CTTGGTGCCCCAGACATAGCTTTCCCCCGCTTAAATAACATAAGGTTCTGACTTCTCCCCCCCTCCTTGACCCTTCTTGTGTCAAGTGCTGCTGTAGAAAAAGGAGCTGGCACAGGATGAACAGTCTACCCCCCACTATCCAGCAATATCGCTCACGCCGGCCCTTCCGTTGATTTA---GCAATTTTTTCTCTTCATTTAGCCGGAGTCTCTTCTATTTTAGGCGCCTTAAATTTTATTACAACTGTTATTAACATACGCTCGAAAGGCCTCCGCCTTGAACGCGTCCCCTTATTTGTATGATCTGTCATAATCACTGCTATTCTTTTACTTCTCAGTCTTCCCGTATTAGCCGGC---GCCATTACAATACTCCTGACAGACTGTAACTTAAATACTGCGTTTTTCGATCCCGCTGGGGGAGGTGACCCC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Nereis sp. 1 DH1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Nereis

Nereis is a genus of polychaete worms in the family Nereidae. It comprises many species, most of which are marine, including the sandworm (Nereis virens) and the common clam worm (Nereis succinea). Nereis possess setae and parapodia for locomotion. They may have two types of setae, which are found on the parapodia. Acicular setae provide support. Locomotor chaetae are for crawling, and are the bristles that are visible on the exterior of the Polychaeta.

Ecology[edit]

Nereis are osmoconformers. Nereids are dioecious and they release their haploid gametes into the water medium, a process called spawning. Moreover, upon fertilization and mitotic divisions of the zygote. Nereids form a larval stage which is similar to that of molluscs – i.e. a trochophore larva.

Species[edit]

The genus Nereis contains the following species:[1]

References[edit]

  1. ^ Geoffrey Read, Kristian Fauchald & Gérard Bellan (2012). "Nereis". In G. Read & K. Fauchald. World Polychaeta database. World Register of Marine Species. Retrieved June 10, 2012. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!