Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Pachylia darceta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 61
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Pachylia darceta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATACTTCATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCATTAAGATTAATAATTCGAGCAGAATTAGGAAACCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCACCAGATATAGCATTCCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCCTCATTAACATTATTAATTTCTAGAAGTATTGTAGAAAATGGAGCTGGAACTGGATGAACAGTTTACCCCCCACTGTCTTCTAATATTGCCCATAGAGGCAGATCAGTCGATCTAGCAATTTTCTCCCTTCATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAACAATTTATCATTTGATCAAATGCCTTTATTTGTGTGAGCTGTAGGAATTACAGCATTCTTATTATTACTATCTTTACCTGTATTAGCAGGTGCAATTACTATACTTTTAACAGATCGAAACTTAAATACATCATTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pachylia darceta

Pachylia darceta is a moth of the Sphingidae family. It is known from Panama, Costa Rica, Venezuela, Brazil and Bolivia.[2]

There are three oblique black lines on the forewing upperside and two in the basal half of the wing. The hindwing upperside is uniform brown without markings.

There are probably multiple generations per year. Adults have been recorded from early August to September in Brazil.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!