Overview

Comprehensive Description

General Description

A fairly large (7.5-9.0 cm. wingspan), narrow-winged moth, smooth dark grey-brown forewings with markings confined to three short, prominent black streaks in the median area, and a smaller one near the apex. Fringe checkered.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Europe and Asia to Japan; occassionally in North America due to accidental introductions. There is a single old Alberta record from the Red Deer area.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

The only Alberta record is for an adult collected in July.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

No Alberta data; elsewhere reported to utilize a variety of Pines (Pinus sp.).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Animal / parasitoid / endoparasitoid
larva of Aphria longirostris is endoparasitoid of larva of Hyloicus pinastri

Animal / parasitoid / endoparasitoid
larva of Ceromya bicolor is endoparasitoid of larva of Hyloicus pinastri
Remarks: Other: uncertain

Plant / pollenated
adult of Hyloicus pinastri pollenates or fertilises flower of Platanthera bifolia
Other: major host/prey

Animal / parasitoid / endoparasitoid
larva of Phryxe nemea is endoparasitoid of larva of Hyloicus pinastri
Remarks: Other: uncertain

Animal / parasitoid / endoparasitoid
larva of Phryxe vulgaris is endoparasitoid of larva of Hyloicus pinastri

Animal / parasitoid / endoparasitoid
larva of Tachina grossa is endoparasitoid of larva of Hyloicus pinastri

Animal / parasitoid / endoparasitoid
larva of Tlephusa cincinna is endoparasitoid of larva of Hyloicus pinastri
Remarks: Other: uncertain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Pine forest.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sphinx pinastri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GACGTTATATTTTATTTTTGGAATCTGAGCAGGAATAGTAGGAACTTCATTAAGTCTATTAATTCGGGCAGAATTAGGAAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACAATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGTGCACCTGATATAGCTTTCCCTCGAATAAATAATATGAGATTTTGGCTTCTTCCCCCTTCTTTAATACTATTAATTTCTAGTAGTGTTGTAGAAAATGGAGCTGGAACAGGATGAACAGTGTACCCCCCACTATCTTCTAATATTGCTCATAGAGGTAGCTCAGTTGATTTAGCTATTTTTTCATTACATTTAGCCGGAATTTCATCTATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATGCGAATTAATAATATATCATTCGATCAAATACCATTATTTGTTTGAGCTGTGGGAATCACAGCATTTTTATTATTATTATCTTTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACAGACCGAAATTTAAATACATCATTTTTTGACCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sphinx pinastri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 50
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hyloicus pinastri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GACGTTATATTTTATTTTTGGAATCTGAGCAGGAATAGTAGGAACTTCATTAAGTCTATTAATTCGGGCAGAATTAGGAAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACAATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGTGCACCTGATATAGCTTTCCCTCGAATAAATAATATGAGATTTTGGCTTCTTCCCCCTTCTTTAATACTATTAATTTCTAGTAGTGTTGTAGAAAATGGAGCTGGAACAGGATGAACAGTGTACCCCCCACTATCTTCTAATATTGCTCATAGAGGTAGCTCAGTTGATTTAGCTATTTTTTCATTACATTTAGCCGGAATTTCATCTATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGAATTAATAATATATCATTCGATCAAATACCATTATTTGTTTGAGCTGTGGGAATCACAGCATTTTTATTATTATTATCTTTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACAGACCGAAATTTAAATACATCATTTTTTGACCCTGCTGGAGGGGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hyloicus pinastri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

A single historical record only. An accidental introduction. No concerns.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sphinx pinastri

Sphinx pinastri, known as the Pine Hawk-moth, is a moth of the family Sphingidae. It is found in Palearctic ecozone and sometimes the Nearctic ecozone. This species has been found in Scotland but is usually found in England.[2]

The larvae feed on Scots Pine, Swiss Pine, Siberian Pine and Norway Spruce.

Description

Sphinx pinastri's wings are gray with black dashes. The wingspan is 2+343+12 inches (70–89 mm).[3] The moth flies from April to August depending on the location.

The back of the thorax is grey with two dark bands around both sides.[4]

Life

The females lay their eggs in groups of 2 or 3 along pine or spruce needles.[3]

References

  1. ^ "CATE Creating a Taxonomic eScience - Sphingidae". Cate-sphingidae.org. http://www.cate-sphingidae.org/taxonomy/Sphinx/pinastri.html. Retrieved 2011-11-01.
  2. ^ The Natural History of British Insects By Edward Donovan (accessed January 12, 2009)
  3. ^ a b Butterflies and Moths of North America (accessed January 12, 2009)
  4. ^ The Naturalist's Library edited by William Jardine (accessed January 12, 2009)

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!