Overview

Comprehensive Description

General Description

A medium-size (3.3-4.5 cm wingspan) pale grey moth. The long silky hair on the body is typical of the genus. The forewings are pale pearl grey shading to white at the wing-base. The normal lines are reduced to a few dark marks, in particular at the costa, and a series of black dots on the outer margin in the spaces between the veins. There are also a few small patches of gold or orange scales along the lower forewing margin. The hindwings are white with a row of prominent back spots between the veins along the margin, and a small dark discal spot. All other Furcula species have a sharply contrasting dark median band crossing the forewings. The nominate subspecies been reported from the Llyodminster region. Subspecies wileyi occurs in the grasslands region of southern Alberta; it is larger and paler than ssp. cinerea.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Nova Scotia west to BC. In Alberta, cinerea occurs in the wooded portions of the valleys in the grasslands region and locally in the aspen parklands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Deciduous forest and shrub
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

No Alberta data. Elsewhere larval hosts are reported to be poplar (Populus sp.) and willow (Salix).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Adults are on the wing late May though mid-July
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

The adults are diurnal and come to lights. Larvae are solitary defoliators. There is a single brood which overwinters as pupae.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Furcula cinerea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGTTTACTAATTCGAGCAGAATTAGGAAACCCCGGATCACTAATTGGAGATGATCAAATTTATAATACTATTGTAACCGCCCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGGGGATTCGGAAATTGATTAGTACCTCTAATATTAGGAGCTCCTGATATAGCATTCCCACGTATAAATAATATAAGATTTTGAATATTACCCCCCTCATTAACCCTTTTAATTTCAAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGCCCATAGAGGAAGATCTGTTGATTTAGCTATTTTTTCCCTACATTTAGCTGGAATCTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGACTTAATAAAATAACATTTGATCAAATACCCCTATTTATTTGAGCAGTTGGAATTACAGCCTTTTTATTATTACTATCTTTACCTGTATTAGCCGGAGCAATTACTATACTTTTAACAGACCGTAATTTAAATACCTCTTTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Furcula cinerea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 42
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

No concerns.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Furcula cinerea

The Gray Furcula Moth (Furcula cinerea) is a moth of the Notodontidae family. It is found in the United States, southern Canada and the Northwest Territories.[2]

The wingspan is 33–45 mm.[3] The forewings are light grey with medium grey median and subterminal areas. The hindwings are light greyish white with a dark discal spot and a terminal line of black dots. Adults are on wing from April to September in the south and from May to August in the north. There are two generations per year in the south. In the north there is only one generation.

The larvae feed on the leaves of Betula, Populus and Salix species. Larvae can be found from spring to fall in the south and from July to August in the north. The species overwinters in the pupal stage.

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Barcode divergences within nominal Furcula cinerea indicate that more than one species may be involved. The genus is in need of revision (Lafontaine and Schmidt 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!