Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Camplyocheta praecox is endoparasitoid of larva of Thyatira batis

Animal / parasitoid / endoparasitoid
larva of Phryxe nemea is endoparasitoid of larva of Thyatira batis

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Thyatira batis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Thyatira batis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCATTAAGTTTACTAATTCGAGCTGAATTAGGTAACCCTGGATCTTTAATTGGGGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCTCCTGATATAGCTTTTCCACGTATAAATAATATAAGATTTTGAATACTACCCCCATCATTAACACTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTTTACCCTCCTCTTTCTTCTAATATTGCTCATAGAGGAAGCTCTGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGATTAAATAATATATCATTTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCTTTTTTATTATTATTATCTTTACCTGTTTTAGCAGGAGCTATTACCATACTTTTAACAGACCGAAATTTAAATACATCATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Peach Blossom

for other uses of this phrase see Peach Blossom (disambiguation)

The Peach Blossom (Thyatira batis) is a moth of the family Drepanidae.[1] It is found throughout Europe and is a fairly common species in the British Isles.

It is a striking species with brown forewings marked with five pink and white blotches which do rather resemble the petals of peach blossom. The hindwings are buff and grey. The wingspan is 40–45 mm. The species flies at night, in western Europe in June and July sometimes with a partial second brood emerges in late August and September. The species is attracted to light and sugar.

The larva is brown with white markings and several humps along its back. At rest it raises both ends as with many drepanids. It feeds on various Rubus species. The species overwinters as a pupa.

  1. ^ The flight season refers to the British Isles. This may vary in other parts of the range.

Subspecies[edit]

References[edit]

Illustration from John Curtis's British Entomology Volume 5
  1. ^ "Peach Blossom at Markku Savela's Lepidoptera pages". Funet.fi. Retrieved 2011-12-19. 
  • Chinery, Michael Collins Guide to the Insects of Britain and Western Europe 1986 (Reprinted 1991)
  • Skinner, Bernard Colour Identification Guide to Moths of the British Isles 1984


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!