Overview

Brief Summary

In its larval stage, Manduca sexta is known as the tobacco hornworm, a large green caterpillar with a distinctive horn on its posterior segment. Because it can grow to a good size (80 mm), a caterpillar can quickly defoliate its solanaceous plant hosts (mainly tomato and tobacco leaves). While M. sexta is trouble for crops, it is more often described as a garden pest. It is native to the New World and found commonly in the United States as far north as New York, across the Midwest, and through central and South America as far south as Argentina. Manduca sexta has many native predators and parasites that control population numbers, including species of Polistes wasps, big-eyed bugs (Hemiptera: Lygaeidae) and lace wings (Neuroptera: Chrysopidae) which prey on the larvae, and parasites Trichogramma spp., Cotesia congregata, and Hyposoter exigua. Larvae that have been parasitized by Cotesia congregata (a braconid wasp) can be seen covered with white pupal cases of larval wasps that emerged from feeding and developing inside the caterpillar’s body. The adult moth is a large dramatic creature known as the Carolina sphinx moth. It feeds nocturnally on flower nectars. The closely related Manduca quinquemaculata (Haworth) has a similar diet and distribution, and the two are often confused; they can be distinguished as larvae by the white markings along the back of the caterpillar and by the number of body spots on the adult moth. Both species usually produce two generations per year.

Manduca sexta has been developed as a model system for biological study, and is used in laboratories investigating a broad spectrum of topics such as neurobiology, flight mechanics, larval nicotine resistance, and regulation of development. It has several advantages for study, including its large size, short life cycle and the fact that it is easily reared in lab conditions. In the lab the caterpillars are blue because the artificial wheat germ diet they are fed does not contain the yellow carotenoid pigments that normally combine with insecticyanins to turn their bodies green. The tobacco hornworm has also been used for research projects and teaching science in secondary and college classrooms (http://www.manducaproject.com/; http://www.acad.carleton.edu/curricular/BIOL/resources/rlink/).

(Villanueva 1998; Lange and Bronson 1981; Wikipedia 2011)

  • Villanueva, R. 1998. Tobacco Hornworm: Manduca sexta (Linnaeus) and Tomato Hornworm: Manduca quinquemaculata (Haworth) (Insecta: Lepidoptera: Sphingidae) UF/IFAS EENY-31, http://creatures.ifas.ufl.edu/field/hornworm.htm.
  • Lange, H. and L. Bronson. 1981. Insect pests of tomatoes. Annu. Rev. Entomol. 263: 45-371.
  • Wikipedia, The Free Encyclopedia. 2 September, 2011. Manduca sexta. Retrieved September 28, 2011 from http://en.wikipedia.org/w/index.php?title=Manduca_sexta&oldid=447988268
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Dana Campbell

Trusted

Article rating from 1 person

Average rating: 2.5 of 5

The Carolina sphinx moth (Manduca sexta) is also known as the tobacco hornworm, hummingbird moth, six-spotted sphinx, and the tobacco fly.

The Carolina sphinx moth has six pairs of yellow bands on its abdomen; indistinct black, brown, and white markings on its forewing with wing fringes spotted with white; and black and white bands and two black zigzag lines on its hindwing. The forewings are long and narrow and larger than the hindwings. These moths have a wing span of two to 12 cm. The caterpillar, known as a tobacco hornworm because the caterpillars feed on the tobacco plant (Nicotiana attenuate), is cylindrical with seven straight white lines with black edges on each side and has a red-tipped horn at the end of its abdomen.

This species is found in tobacco fields, vegetable gardens, and a wide variety of other habitats. The Carolina sphinx moth is found in Massachusetts west across southern Michigan to Minnesota, central Colorado, and northern California; south to Florida, the Gulf Coast, Texas, New Mexico, Arizona, and southern California. It is secure globally, though may be rare in parts of its range.
  • Taxonomic Groups: Family: Sphinx Moths, Hawkmoths (Sphingidae) (Butterflies and Moths of North America)
  • Fact Sheets: Hawk Moths (Australian Museum)
  • Species Detail: Carolina Sphinx (Butterflies and Moths of North America)
  • Hawk Moth and the Sacred Datura: A Mutual Aid Society (Mari N. Jensen, In Report on Research, Winter 2004-2005, vol. 21, no. 1, University of Arizona)
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Records from locations in central and southern U.S. states, south to Mexico. Fewer and more scattered locations than M. QUINQUEMACULATA (Smith, 1995), although the two are about equally frequent in much of the eastern USA. It ranges over most of the United States and is represented in Central and South America by several subspecies or local races (Holland, 1915). Also, scattered records from ND, NE, OK, TX, CO, NM, ID, UT, NV, OR, and Mex. (Smith, 1995). Adults may be found flying throughout the year in southern Florida, elsewhere it is mainly a summer to early fall species. It is most common along the Gulf Coast, up through the Mississippi Valley and along the East Coast to Maryland and New Jersey. It reaches the southeastern part of New York, Connecticut and southeastern Massachusetts. Pupae can survive winters in New Jersey and Connecticut (Schweitzer, 2006) and the species appears to be resident virtually to its northeastern limit. It occurs somewhat sporadically in southern Ontario, the southern half of the Lower Peninsula of Michigan and probably occurs west into Minnesota and might not be winter-hardy in those areas. It has been taken in the mountains of southern Arizona but not in the higher regions of the Coconino Plateau, perhaps because of the shortness of the growing season in the latter area. It occurs in southern California and north into the San Joaquin Valley (Hodges, 1971).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Comments: A pest species whose larvae are found on tomato, potato, tobacco, and other solanaceous plants (Hodges, 1971).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Flowering Plants Visited by Manduca sexta in Illinois

Manduca sexta Linnaeus: Sphingidae, Lepidoptera
(observations are from Sheviak & Bowles and Bertin; this moth is referred to as the 'Tobacco Hornworm' and 'Carolina Sphinx')

Bignoniaceae: Campsis radicans sn (Brt); Orchidaceae: Platanthera leucophaea sn (SB)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Estimate thousands of occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: This was one of our commonest hawkmoths (Holland, 1915) but is less abundant now with the widespread use of insecticides on farms. Still this is a very widespread moth and it larva is well-known to most persons who have grown tomatoes from Connecticut to Florida and westward. The species is probably most common along the Gulf Coast, up through the Mississippi Valley and along the east coast to MD and NJ (Hodges, 1971). A pest (Covell, 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Adults of SEXTA may be found flying throughout the year in Florida, elsewhere it is mainly a summer to early fall species (Hodges, 1971). May through October (Covell, 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Females lay a single egg on the upperside of a host plant leaf. Hostplants include potato, tobacco, tomato, and other plants in the nightshade (Family: Solanaceae) family. The female will lay up to 100 eggs in a season. Eggs hatch in two to eight days and the larva emerges. Caterpillars pupate and overwinter in burrows in the soil for one to 25 weeks. An adult emerges and lives for several weeks. The life cycle has between two and four generations per year and the insects are typically active in late summer through fall.
  • Taxonomic Groups: Family: Sphinx Moths, Hawkmoths (Sphingidae) (Butterflies and Moths of North America)
  • Fact Sheets: Hawk Moths (Australian Museum)
  • Species Detail: Carolina Sphinx (Butterflies and Moths of North America)
  • Hawk Moth and the Sacred Datura: A Mutual Aid Society (Mari N. Jensen, In Report on Research, Winter 2004-2005, vol. 21, no. 1, University of Arizona)
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Manduca sexta

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGL4922-08|NC_010266|Manduca sexta| CGAAAATGACTTTATTCTACAAATCATAAAGATATTGGAACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCTTTA---AGCTTATTAATTCGAGCAGAATTAGGTAATCCAGGATCATTAATTGGTGAT---GATCAAATTTATAATACAATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGGGGATTTGGAAATTGATTAGTACCTTTAATA---TTGGGGGCCCCAGATATAGCCTTTCCCCGAATAAATAATATAAGATTTTGACTTTTGCCCCCCTCTTTAATACTACTAATTTCTAGTAGTATTGTAGAAAATGGAGCTGGTACAGGTTGAACAGTATACCCACCTTTATCATCTAATATTGCTCATAGTGGAAGATCTGTTGATTTA---GCAATTTTTTCTTTACATTTAGCAGGTATTTCATCTATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATGCGAATTAATAATATATCATTTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCATTTTTATTATTATTATCTTTACCTGTATTAGCAGGA---GCAATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTCTTATTTTACCTGGATTTGGAATAATTTCTCATATTATTTCCCAAGAAAGAACTAAAAAA---GAAACATTTGGATGTTTAGGAATAATTTATGCTATAATAGCAATTGGTTTATTAGGATTTATTGTATGAGCTCATCATATATTTACAATTGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Manduca sexta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 23
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Described as a "pest" and "one of our commonest hawkmoths" (Covell, 1984; Holland, 1915). This highly vagile species may be less susceptible to habitat loss or alteration than species with low vagility.

Other Considerations: Relatively highly vagile adults can be recorded far from breeding and larval habitats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Increase of 10 to >25%

Comments: A pest species that is increasing due to association with land converted for agriculture.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Pollinator

These moths are important pollinators of deep-throated, night-blooming flowers. The moth extends its long proboscis (a hollow straw-like organ) up to 10 cm into the flower to collect nectar. As the moth removes its proboscis from the flower, pollen grains stick to it and become entrapped on the scales of the moth's body. As it nectars on other plants, it inadvertently deposits this pollen on other flowers and pollinates the plant.

Hawk moths are such good pollinators that some plants have developed distinct pollination syndromes to attract them. One example is the large white petunia (Petunia axillaris), that emits a strong odor during the night to attract hawk moths. Other examples of plants pollinated by the Carolina sphinx moth include Colorado four-o'clock (Mirabilis froebelii), periwinkles (Mandevilla longiflora, Mandevilla petraea), wild tobacco (Nicotiana attenuata), agaves (Agave spp.), and jimsonweed (Datura wrightii). An interesting mutualism has developed between the Carolina sphinx moth and jimsonweed. Larvae are major herbivores of jimsonweed, feasting on the leaves. However, the plant has developed mechanisms to deal with this herbivory - the plant stores resources in its massive roots that can be allocated to new leaf production. In return, the moth is a major pollinator of jimsonweed, whose large white funnel-shaped flowers bloom at night and are filled with nectar. Jimsonweed plants pollinated by the moth have heartier seedlings than those plants that are self-pollinated.

However, the larval stage of this species is considered an agricultural pest. Larvae can defoliate a plant overnight including crop plants like tobacco, tomatoes, potatoes, peppers, and eggplants.

  • Floral trait associations in hawkmoth-specialized and mixed pollination systems, J. A. Riffell, R. Alarcon, L. Abrell, Communicative and Intergrative Biology 1(1):6-8. 2008
  • Hawkmoth pollination of Mirabilis longiflora (Nyctaginaceae), K. A. Grant, Proceedings of the National Academy of Science, vol. 80, no. 5, 1983, pp. 1298-1299, Pollinator Digital Conservation Library
  • Context- and scale-dependent effects of floral CO2 on nectar foraging by Manduca sexta, J. Goyret, P. M. Markwell, and R. A. Raguso, vol. 105, no. 12, pp. 4565-4570, March 25, 2008, Proceedings of the National Academy of Sciences
  • Night-fliers and the High Cost of Jimsonweed's Pollination, Jennifer Graber, Friends of Madera Canyon
  • Hawk Moth and the Sacred Datura: A Mutual Aid Society, Mari N. Jensen, In Report on Research, Winter 2004-2005, vol. 21, no. 1, University of Arizona
  • The Plants that Love Hawkmoths, Arthur C. Gibson, Mildred E. Mathias Botanical Garden Newsletter, Spring 2001, vol. 4, no. 2
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Manduca sexta

Manduca sexta is a moth of the family Sphingidae present through much of the American continent. Commonly known as the tobacco hornworm, it is closely related to and often confused with the very similar tomato hornworm (Manduca quinquemaculata); the larvae of both feed on the foliage of various plants from the family Solanaceae. The tobacco hornworm can be distinguished by its seven diagonal lines on its sides; tomato hornworms have eight V-shaped markings.[2] A mnemonic to remember the markings is tobacco hornworms have straight white lines like cigarettes, while tomato hornworms have V-shaped markings (as in "vine-ripened" tomatoes). M. sexta has mechanisms for selectively sequestering and secreting the neurotoxin nicotine present in tobacco.[citation needed]

M. sexta is a common model organism, especially in neurobiology, due to its easily accessible nervous system and short life cycle. It is used in a variety of biomedical and biological scientific experiments. It can be easily raised on a wheat-germ based diet. The larva is large and thus relatively easy to dissect and isolate organs.

Contents

Subspecies

  • Manduca sexta sexta (from Massachusetts west across southern Michigan to Minnesota, central Colorado, and northern California, south to Florida, the Gulf Coast, Texas, New Mexico, Arizona, and southern California and then further south through Mexico, Belize, Honduras, Nicaragua, Costa Rica, and the West Indies to Argentina)
  • Manduca sexta caestri (Blanchard, 1854) (Chile)
  • Manduca sexta jamaicensis (Butler, 1875) (Jamaica, the Dominican Republic, St. Lucia, Guadeloupe and throughout the Antilles)
  • Manduca sexta leucoptera (Rothschild & Jordan, 1903) (Galapagos Islands)
  • Manduca sexta paphus (Cramer, 1779) (Surinam and Venezuela to Brazil, Argentina and Bolivia)
  • Manduca sexta saliensis (Kernbach, 1964) (Argentina)

Life cycle

M. sexta has a short life cycle, lasting about 30 to 50 days. In most areas, M. sexta has about two generations per year, but can have about three or four generations per year in Florida.[3]

Eggs

M. sexta eggs are spherical, approximately 1 millimeter in diameter, and translucent green in color. They typically hatch two to four days after they are laid. Eggs are normally found on the underside of foliage, but can also be found on the upper surface.

Larvae

M. sexta larva
M. sexta later instar
A tobacco hornworm with parasitic wasp cocoons
Hornworm caterpillars and their fecal material

M. sexta larvae are green in color and grow up to 70 millimeters in length. Under laboratory conditions, while fed a wheat-germ based diet, larvae are turquoise due to a lack of pigments in their diet. M. sexta blood contains the blue-colored protein insecticyanin. When the larva feeds on plants, it ingests pigmentacious carotenoid proteins. Carotenoids are primarily yellow in hue. When bound together, the protein complex is green.

During the larval stage, M. sexta caterpillars feed on plants of the family Solanaceae, principally tobacco, tomatoes and members of the genus Datura. Near the end of this stage, the caterpillar seeks a location for pupation, burrows underground, and pupates. The searching behaviour is known as "wandering". The instinct of wandering can be visually confirmed by spotting the heart (aorta) which is a long, pulsating vein running along the length of the caterpillar's dorsal side. The heart appears just as the caterpillar is reaching the end of the final instar. M. sexta has five larval instars which are separated by ecdysis (molting), but may add larval instars when nutrient conditions are poor.

A common biological control for hornworms is the parasitic braconid wasp, Cotesia, which lays its eggs in the bodies of tobacco hornworms. The wasp larvae feed internally, and emerge from the body to spin their cocoons. Parasitized tobacco hornworms are often seen covered with multiple white, cottony wasp cocoons, which are often mistaken for large eggs.

Pre-pupae

Tobacco hornworm pre-pupa

Before the larva pupates, it goes through a stage called the pre-pupa, where its shrinks considerably and prepares to pupate. Often, people mistake this stage as a dead, or dying, caterpillar.

Pupae

The pupal stage lasts approximately 18 days under laboratory conditions (17 hours light, 7 hours dark, 27 °C). When reared on a short-day photoperiod (12 hours light, 12 hours dark), pupae enter a state of diapause that can last several months. During the pupal stage, structures of the adult moth form within the pupal case which is shed during eclosion (adult emergence).

Adults

Adult M. sexta are known as Carolina sphinx moths. M. sexta moths are nectarivorous and feed on flowers, demonstrating a remarkable ability to hover.

Adult males and females are sexually dimorphic. Males are identifiable by their broader antennae and the presence of claspers at the end of the abdomen. Female moths are typically ready to mate one week after eclosion, and do so only once. Males may mate many times. Mating generally occurs on a vertical surface at night, and can last several hours, with the male and female facing in opposite positions, their posterior ends touching. After mating, females deposit their fertilized eggs on foliage, usually on the underside of leaves.

Laboratory rearing

Hornworm eating
Illustration from John Curtis's British Entomology Volume 5, possibly the only British record for this species

Like Drosophila melanogaster, M. sexta is commonly used as a model organism for experiments. They are frequently studied in the laboratory due to their large size and relative ease of rearing. They may be reared on host plants, such as tobacco and tobacco relatives, tomato plants, or wheat germ-based artificial diet. Their rearing is straightforward, as long as they receive a "long day" (i.e., 14 hour) daylight cycle during development to prevent diapause.

Eggs are rinsed for one to five minutes in diluted household bleach for disinfection.

Eggs are placed on diet cubes or host plants. The eggs hatch and develop at different speeds depending on temperature. The larvae are moved to fresh diet or leaves as their food spoils or is consumed. When they start to "wander", they are about to pupate, so are placed in a pupation chamber. Pupation chambers are holes drilled into a wood board. The Manduca larvae are sealed in the chamber using a stopper, and allowed to pupate. After pupation, the pupae are placed in a breeding or colony chamber to eclose. Providing a cup of sugar water and a tobacco (or related plant) will allow mated females to oviposit fertile eggs, which can then be reared.

When fed an artificial diet, Manduca larvae do not consume the xanthophyll needed to produce their green coloration; instead they appear blue. On some diets, they have very little pigment and pigment precursors, so are a very pale blue-white. As vitamin A and other carotenoids are necessary for the visual pigments (rhodopsin,) an artificial diet-reared hornworm may have poor vision due to lack of carotenoids in the diet.[citation needed]

Hornworm Moth Variety

References

  1. ^ "CATE Creating a Taxonomic eScience – Sphingidae". Cate-sphingidae.org. http://www.cate-sphingidae.org/taxonomy/Manduca/sexta.html. Retrieved June 16, 2011. 
  2. ^ Villanueva, R. (2007). "Tobacco hornworm, Manduca sexta (Linnaeus). Featured Creatures". http://entomology.ifas.ufl.edu/creatures/field/hornworm.htm. Retrieved July 24, 2008. 
  3. ^ Eichman, Aaron; Weston Tripp, Matt Edwards (2000). "Manduca sexta "Carolina sphinx"". Archived from the original on 2006-09-08. http://web.archive.org/web/20060908162724/http://bugs.clemson.edu/museum/moths/local/moth1.htm. Retrieved October 21, 2006. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!