Molecular Biology and Genetics

Molecular Biology

Barcode data: Manduca boliviana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AACATTATATTTTATTTTTGGAATTTGGGCAGGAATAGTGGGAACTTCTTTGAGTTTATTAATTCGAGCAGAATTAGGTAATCCTGGATCATTAATTGGAGATGATCAAATTTATAATACAATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATGGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCCCGTATAAACAATATAAGATTTTGACTCTTACCACCCTCTTTAATACTATTAATTTCTAGTAGTATTGTAGAAAATGGAGCTGGAACAGGTTGAACTGTTTACCCCCCTTTATCATCCAACATTGCCCATAGAGGAAGATCAGTTGATTTAGCAATTTTCTCTCTTCACTTAGCAGGAATTTCATCCATTTTAGGAGCAATTAATTTTATTACCACAATTATTAATATACGAATTAACAACATATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTTTTATTATTATTATCTTTACCTGTTTTAGCGGGTGCAATCACAATATTATTAACAGATCGAAACTTAAATACATCATTTTTTGATCCTGCTGGAGGGGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Manduca boliviana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Manduca boliviana

Manduca boliviana is a moth of the Sphingidae family. It is known from Bolivia.[2]

The length of the forewings is about 44 mm. It is similar to Manduca scutata and Manduca brasiliensis, but smaller, much lighter coloured and the forewings are shorter and more rounded than the latter. The forewing upperside ground colour is light grey and the forewing underside is light, with three strongly marked postmedian bands and a broad marginal band. The hindwing upperside has a white submarginal band and the hindwing underside postmedian band is narrower and more marked than in Manduca scutata and Manduca brasiliensis.

References[edit]

  1. ^ "CATE Creating a Taxonomic eScience - Sphingidae". Cate-sphingidae.org. Archived from the original on 2012-11-14. Retrieved 2011-11-01. 
  2. ^ "Silkmoths". Silkmoths.bizland.com. Retrieved 2011-11-01. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!