Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Manduca jasminearum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGTTATCCAGGATCTTTAATTGGAGATGATCAAATTTACAATACAATCGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGGCTTCTTCCCCCTTCTTTAATATTATTAATTTCTAGTAGTATTGTAGAAAATGGAGCCGGAACAGGATGAACAGTATATCCCCCCTTATCTTCTAATATTGCTCATAGAGGTAGATCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGTATTTCATCTATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGAATTAATAATATATTTTTTGATCAAATACCATTATTTGTATGAGCTGTAGGTATTACAGCATTTTTATTATTATTATCTTTACCTGTTTTAGCGGGTGCAATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGGGGTGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Manduca jasminearum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: While it apparently was very scarce in the Northeast in the mid 20th century, it is no longer at all rare in northern New Jersey or Pennsylvania and southward. As with all of the ash feeding Sphingidae for now the rank does not really take into account potential impacts from the Emerald Ash Borer but reflects only current status as of about 2011. If that beetle actually does virtually eradicate ash from eastern North America, which is as of 2011 the plausible worst case scenario, this moth would almost certainly go extinct. This one is not known to have any alternate foodplants although most other ash-feeding Sphinginae can use exotic privets and perhaps native Chionanthus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: Has experienced range-wide declines (Opler, 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Manduca jasminearum

The Ash Sphinx (Manduca jasminearum) is a member of the Sphingidae family of moths. It ranges from east of the Mississippi River to the Atlantic Ocean, being common in the Northeast United States.[2]

The wingspan is 84–105 mm. There are two generations per year with adults on wing from May to September. They nectar at flowers.

The larva of this species mainly feed on Ash species (Fraxinus), but have also been recorded on Syringa and Ulmus species.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!