Molecular Biology and Genetics

Molecular Biology

Barcode data: Manduca brontes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGTAATCCGGGATCATTAATTGGAGATGATCAAATTTATAATACAATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATCGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGTGCCCCTGATATAGCTTTCCCCCGAATAAACAACATAAGATTTTGGCTTCTTCCCCCCTCTTTAATATTATTAATTTCTAGAAGTATTGTAGAAAATGGAGCTGGAACAGGTTGAACAGTATATCCCCCTCTATCATCAAATATTGCTCATAGCGGAAGATCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCATCTATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTTTTATTATTATTATCATTACCTGTATTAGCAGGTGCAATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGGGGGGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Manduca brontes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Manduca brontes

Manduca brontes is a species of moth in the family Sphingidae. It is known from Jamaica, Cuba, Haiti, Puerto Rico, the Cayman Islands, the Dominican Republic and Suriname.[2]

Adults are on wing from April to June in Florida.

The larvae have been recorded feeding on Tecoma species (including Tecoma stans), Fraxinus americana, Fraxinus excelsior and Fraxinus platycarpa.

Subspecies[edit]

  • M. brontes brontes (Jamaica and Cuba, Greater Antilles and northern South America)
  • M. brontes cubensis (Kitching and Cadiou, 2000) (Cuba, Haiti, Puerto Rico, the Cayman Islands and Florida)
  • M. brontes haitiensis (B.P. Clark, 1916) (Haiti and the Dominican Republic)
  • M. brontes pamphilius (Cramer, 1782) (Suriname)

References[edit]

  1. ^ "CATE Creating a Taxonomic eScience - Sphingidae". Cate-sphingidae.org. Retrieved 2011-11-01. 
  2. ^ "Silkmoths". Silkmoths.bizland.com. Retrieved 2011-11-01. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!