Molecular Biology and Genetics

Molecular Biology

Barcode data: Manduca armatipes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATGGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCTGATATAGCCTTCCCCCGAATAAATAATATAAGATTTTGGCTTCTACCCCCCTCTTTAATATTACTAATTTCTAGTAGTATTGTAGAAAATGGAGCCGGAACAGGCTGAACAGTTTACCCCCCTTTATCATCTAATATTGCTCATAGAGGTAGATCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGTATTTCATCTATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGAATTAATAATATATTATTTGATCAAATACCATTATTCGTGTGAGCTGTAGGTATTACAGCATTTTTATTATTATTATCTTTACCTGTTTTAGCAGGTGCTATTACTATATTATTAACAGACCGAAATTTAAACACATCATTTTTTGATCCTGCTGGAGGAGGTGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Manduca armatipes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Manduca armatipes

Manduca armatipes is a moth of the Sphingidae family. It is found from Argentina and Uruguay to Bolivia.[2]

The wingspan is about 96 mm. It is similar in colour and pattern to Manduca lichenea, but the hindwing upperside is more extensively grey, with a patch posterior to the discal cell extending to the more proximal of the median dark bands. Furthermore, the transverse lines on the forewing upperside are more prominent.

Adults are on wing in November and February.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!