Molecular Biology and Genetics

Molecular Biology

Barcode data: Manduca andicola

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGGGCAGAATTAGGTAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACAATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGGTTTGGAAATTGATTAGTCCCATTAATATTAGGAGCTCCTGATATAGCCTTCCCACGAATAAATAATATAAGATTTTGACTTTTACCCCCCTCCTTAATATTATTAATTTCTAGAAGTGTTGTAGAAAATGGGGCTGGAACAGGATGAACAGTATACCCCCCTTTATCAGCTAATATTGCTCATAGAGGTAGATCTGTTGATTTAGCTATTTTCTCTTTACATTTAGCAGGTATTTCATCTATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCATTCTTATTATTACTATCTTTACCAGTATTAGCTGGAGCAATTACTATATTATTAACAGATCGAAATTTAAATACATCATT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Manduca andicola

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Manduca andicola

Manduca andicola is a moth of the Sphingidae family. It is found from Central America to Peru, Ecuador, Bolivia and Argentina.[2]

It is similar to Manduca lefeburii, Manduca incisa and Manduca jasminearum in having a relatively uniform forewing upperside with a conspicuous, rather diffuse dark band running from about midway along the costa to the outer margin and incorporating the discal spot.

Adults fly as three generations in the subequatorial zone, with adults on wing from December to January, May to June and in October.

The larvae feed on plants in the Annonaceae family.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!