Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Manduca albiplaga

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 35
Specimens with Barcodes: 61
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Manduca albiplaga

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 39 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNAACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACCTCCTTAAGTCTATTAATCCGAGCAGAACTAGGAATACCCGGATCTTTAATTGGTGATGATCAAATTTATAATACAATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCTATTATAATCGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGGGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGGCTTCTCCCCCCTTCTTTAATACTATTAATTTCTAGTAGTATTGTTGAAAATGGAGCTGGAACAGGTTGAACAGTTTACCCCCCTTTATCGTCAAATATTGCCCATAGAGGTAGTTCTGTTGATTTAGCTATTTTCTCACTTCATTTAGCAGGTATTTCATCAATTTTAGGAGCCATTAATTTTATTACTACAATTATTAATATACGAATTAATAATATAACATTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCTTTTTTATTATTATTATCTCTGCCTGTATTAGCAGGTGCTATTACTATATTACTAACAGATCGAAATTTAAATACATCATTTTTTGACCCAGCTGGGGNAGGAGATCCAATTTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Manduca albiplaga

The White-plaqued Sphinx (Manduca albiplaga) is a member of the Sphingidae family of moths. Its range is from Brazil to southern Mexico, although a stray has been recorded as far north as Kansas.

Its wingspan is 60–72 mm.

The larvae feed on plants of the Boraginaceae family and some in the Annonaceae family including Rollinia deliciosa.

References[edit]

  1. ^ "CATE Creating a Taxonomic eScience - Sphingidae". Cate-sphingidae.org. Retrieved 2011-11-01. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!