Molecular Biology and Genetics

Molecular Biology

Barcode data: Macropoliana natalensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAACCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTAACAGCCCATGCATTTATTATAATTTTTTTTATAGTGATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTGGGAGCCCCTGATATAGCATTCCCACGTATAAATAATATAAGTTTTTGACTCCTACCCCCTTCTTTAATACTATTAATTTCTAGAAGTATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTTTACCCCCCTTTATCTTCAAATATCGCTCATAGAGGAAGATCAGTAGATTTAGCAATTTTCTCATTGCATCTTGCTGGTATTTCTTCTATTTTAGGTGCAATTAATTTTATTACCACAATTATTAATATACGGATTAATAATATATCATTTGATCAAATACCATTATTTGTTTGAGCTGTTGGAATTACAGCATTCTTATTACTATTATCCTTACCTGTTTTAGCTGGAGCTATTACTATACTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGTGGGGGGGACCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Macropoliana natalensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 34
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Macropoliana natalensis

Macropoliana natalensis is a moth of the Sphingidae family. It is known from forests and moist woodland from KwaZulu-Natal to Ethiopia and westwards to Cameroon, Ghana and Sierra Leone.[2]

The length of the forewings is 55-70 mm for males and 65-75 mm for females and the wingspan is 107-126 mm. The forewings are very pale grey with wavy blackish transverse bands and a whitish stigma. There are two short longitudinal blackish streaks in the centre of the wing. The head is pale grey and the thorax is pale grey surrounded dorsally by black lines edged internally with yellow. The abdomen is pale grey, mottled and faintly spotted with darker grey. The hindwings are dark greyish brown, with a large pale grey patch near the tornus. Females are larger, have broader forewings and are usually darker and more heavily marked.

The larvae feed on Spathodea nilotica, Spathodea campanulata, Markhamia lutea and Brachystegia species. The larvae are generally pale green, but turn olive-purple immediately before pupation. Pupation takes place under ground in a dark brown pupa.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!