Overview

Distribution

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Carcelia puberula is endoparasitoid of larva of Lymantria monacha

Animal / parasitoid / endoparasitoid
larva of Lydella stabulans is endoparasitoid of larva of Lymantria monacha

Animal / parasitoid / endoparasitoid
larva of Parasetigena silvestris is endoparasitoid of larva of Lymantria monacha

Animal / parasite / endoparasite
larva of Sarcophaga aratrix endoparasitises Lymantria monacha

Animal / parasite / endoparasite
larva of Sarcophaga caerulescens endoparasitises Lymantria monacha

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Lymantria monacha

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 35
Specimens with Barcodes: 79
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Lymantria monacha

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 63 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGTATTTGATCTGGTATAGTAGGAACTTCTCTTAGTTTATTAATCCGAGCTGAATTAGGAAATCCAGGATCATTAATTGGAAATGATCAAATTTATAATACGATTGTAACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGGGCTCCAGATATAGCCTTCCCCCGTATAAATAATATAAGATTTTGATTACTACCCCCATCATTAACCCTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCCGGTACAGGATGAACAGTTTACCCCCCACTTTCATCAAATATTGCTCATGGAGGAAGATCAGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGTATCTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATGCGATTAACTAATCTATCATTCGATCAAATACCATTATTTATTTGAGCTGTAGGAATTACAGCTTTCCTTCTTTTATTATCATTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGGGGAGATCCAATTCTTTATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Black Arches

The Black Arches or Nun Moth, Lymantria monacha[1] is a small Palaearctic moth.

Description[edit]

The moth has white forewings with black connected wavy arches which gives the moth its name. The light brown hindwings have white fringes having black spots. Female is larger and has elongated wings. The moth also has a characteristic biscuit-coloured abdomen with a black band. The moth has a wingspan of 4 to 5 cm.[1]

Range[edit]

Europe. British Isles. Palearctic regions of Asia. Japan.[1]

Life cycle[edit]

The caterpillar of the Black Arches is grey and hirsute. It has black lines and spots on its back.[1]

Foodplants[edit]

Oak (Quercus) and other broad-leaved trees, and Pinus.[1]

Gallery[edit]

See also[edit]

References[edit]

  1. ^ a b c d e Carter, David. Butterflies and Moths, Dorling Kindersley, pg 271
  • Carter, David (1992) Butterflies and Moths. Dorling Kindersley Handbooks, London. ISBN 0-7513-2707-7.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!