Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) The most widely distributed hawk moth in the Americas. Occurs, at least as stray, and in most states as resident, in all of the lower 48 states and southern Canada, as well as nearly all of Mexico, Central America and most of South America. the northern limits for residency are probably similar to M. sexta. However, M. quniquemaculatus is far less common than M. sexta in southern New England to New Jersey, at least as larvae in gardens, and in all stages in the Deep South, and strays into Canada, so it may be more of a transient species eastward than generally supposed. For eastern US range see Schweitzer (2006), for borader North american range see Tuttle (2009).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Ecology

Habitat

Comments: Similar to M. sexta, in the east a species of weedy fields and aglands. Riparian areas in deserts and othe natural habitat are used from about Arizona southward.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

While the extent and significance of any migrations is unknown, this species shows a similar phenology to the highly migratory Agrias cingulatus in Louisiana, and both species reach far beyond their normal ranges, i.e. into northern New England and the Canadian Maritimes by autumn.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: A similar array of Solanaceous plants as used by M. sexta. One possible exception, oviposition and larvae are seen somewhat regularly on the weedy native Solanum carolinianum (horsenettle) in New Jersey and Pennsylvania. those of the generally much more common M. sexta are not. Also M. sexta is by far the most common of the two on tomato there.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Flowering Plants Visited by Manduca quinquemaculata in Illinois

Manduca quinquemaculata Haworth: Sphingidae, Lepidoptera
(observations are from Robertson, Smith & Snow, and Sheviak & Bowles; this is the Five-Spotted Hawk Moth; it is also called the Tomato Hornworm Moth)

Orchidaceae: Platanthera blephariglottis sn (SS), Platanthera praeclara sn np (SB); Solanaceae: Datura stramonium stramonium sn (Rb), Datura stramonium tatula sn (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Like several other species of manduca, this one is likely to be a significantl pollinator of some native desert plants and very possibly orchids. However, this sould not be obligate for the moths, whether or not it is of the flower. The moths visit many kinds of flowers. S Tuttle (2009) or the Internet.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Apparently similar to Manduca sexta, typically two broods eastward, more where adults appear before mid or late June. There is probably usually one in Arizona. Unlike M. sexta, this species does appear northward along the east coast in the fall like other migratory hawk moths and does reach beyond its normal range, into northern New England and eastern Canada, then. While M. quinquemaculata is apparently rather rare there, its phenology is quite different from M. sexta in Louisiana. While 96% of M. sexta records there are from May to September, 12% of those for M. quniquemaculata are in march or April and another 7% are in October.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Manduca quinquemaculatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCATTAAGTTTATTAATTCGAGCAGAATTAGGTAACCCAGGATCATTAATTGGAGATGATCAAATTTATAATACAATTGTTACAGCACATGCATTTATTATAATTTTTTTTATAGTAATGCCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGTATAAATAATATAAGATTTTGATTATTACCTCCCTCTTTAATATTACTAATTTCTAGTAGTATTGTAGAAAATGGGGCTGGAACAGGATGAACAGTATATCCCCCACTATCATCTAATATTGCTCATAGAGGAAGATCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCAGGTATTTCATCTATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGAGTTAATAATATATCATTTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCATTTTTATTATTATTATCTTTACCTGTTTTAGCTGGAGCAATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTCTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Manduca quinquemaculatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Manduca quinquemaculata

The five-spotted hawkmoth (Manduca quinquemaculata) is a brown and gray hawk moth of the Sphingidae family. The caterpillar, often referred to as the tomato hornworm, can be a major pest in gardens. Tomato hornworms are closely related to (and sometimes confused with) the tobacco hornworm (Manduca sexta). This confusion arises because caterpillars of both species feed on the foliage of various plants from the family Solanaceae, so either species can be found on tobacco or tomato leaves, and the plant on which the caterpillar is found does not indicate its species. The larvae of these species can be distinguished by their lateral markings: tomato hornworms have seven V-shaped markings while tobacco hornworms have seven diagonal lines.[2] Furthermore, the caterpillars can be distinguished from the larval stage onwards by the color of the horns on their back ends: M. quinquemaculata caterpillars have black horns, while M. sexta caterpillars have red horns. The moths can be distinguished by the number of spots on their abdomens, with M. quinquemaculata having, as its name suggests, five.[2]

Range[edit]

M. quinquemaculata is found throughout the United States, northwestern Mexico, and even southern Canada, but is less frequently found throughout the Great Plains and the southeast.

Food plants[edit]

Tomato hornworms are known to eat various plants from the family Solanaceae, commonly feeding on tomato, eggplant, pepper, tobacco, moonflowers and potato. Accordingly, they are often found on defoliated tomato plants, the caterpillar clinging to the underside of a branch near the trunk. They are difficult to spot due to their green coloration. Tomato hornworms fluoresce differently from tomato leaves. Using an ultraviolet light source of 375 nm and viewed behind a blue-blocking filter (yellow or amber filter), a tomato hornworm fluoresces in bright green while a tomato leaf appears deep red/amber. This sharp color contrast helps gardeners locate tomato hornworms at night. They can be reduced by planting marigold flowers around these plants.[3]

Life cycle[edit]

Egg[edit]

Hornworm eggs are spherical to oval in shape, measure about 1.5 mm (0.059 in) in diameter, and vary in color from light green to white. Eggs are deposited principally on the lower surface of foliage, but also on the upper surface. Duration of the egg stage is two to eight days, but averages five days.[2]

Larva[edit]

The tomato hornworm is a green caterpillar, with eight light-green v-shaped markings which extend from the dorsal line to its sides. At the rear end, the caterpillar has a black, bumpy horn, from which the name for the "hornworm" is derived. Nine spiracles (colored black and yellow) appear on each side of the body and are used for respiration.

Caterpillars can be prey to parasitoid wasps of the family Braconidae.

Pupa[edit]

During the summer months, moths will emerge from pupae in about two weeks. Moths emerge from the soil, mate, and then begin to deposit the eggs of the next generation on tomato plants. By early fall, the pupae will remain in the soil all winter and emerge as a moth the following spring. They have been found on other green leaf plants such as moon flowers.

Images[edit]

References[edit]

  1. ^ "CATE Creating a Taxonomic eScience - Sphingidae". Cate-sphingidae.org. Retrieved 2011-11-01. 
  2. ^ a b c Villanueva, Raul (June 1998). "Tobacco Hornworm". Retrieved 2006-10-21. 
  3. ^ "Marigolds". Davis Wiki. 1999-02-22. Retrieved 2011-11-01. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!