Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Carcelia atricosta is endoparasitoid of larva of Orgyia antiqua

Animal / parasitoid / endoparasitoid
larva of Carcelia rasa is endoparasitoid of larva of Orgyia antiqua

Animal / parasitoid / endoparasitoid
larva of Compsilura concinnata is endoparasitoid of larva of Orgyia antiqua

Animal / parasitoid / endoparasitoid
larva of Nilea hortulana is endoparasitoid of larva of Orgyia antiqua

Foodplant / open feeder
caterpillar of Orgyia antiqua grazes on live leaf of Rosa
Remarks: season: -7/8

Foodplant / open feeder
caterpillar of Orgyia antiqua grazes on live leaf of Rhododendron
Remarks: season: -7/8

Foodplant / open feeder
caterpillar of Orgyia antiqua grazes on live leaf of Crataegus
Remarks: season: -7/8

Foodplant / open feeder
caterpillar of Orgyia antiqua grazes on live leaf of Pyracantha
Remarks: season: -7/8

Foodplant / open feeder
caterpillar of Orgyia antiqua grazes on live leaf of Ceanothus
Remarks: season: -7/8

Foodplant / open feeder
caterpillar of Orgyia antiqua grazes on live leaf of Buddleja
Remarks: season: -7/8

Foodplant / open feeder
caterpillar of Orgyia antiqua grazes on live leaf of Ericaceae
Remarks: season: -7/8

Foodplant / open feeder
caterpillar of Orgyia antiqua grazes on live leaf of Prunus
Remarks: season: -7/8

Foodplant / open feeder
caterpillar of Orgyia antiqua grazes on live leaf of Malus sylvestris sens.str.
Remarks: season: -7/8

Animal / parasitoid / endoparasitoid
larva of Pales pavida is endoparasitoid of larva of Orgyia antiqua

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Orgyia antiqua

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 46 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCTGGTATAATTGGAACTTCCATAAGATTATTAATTCGAGCAGAATTGGGAAACCCAGGTTCATTAATTGGGAATGATCAAATTTATAATACCATTGTAACTGCTCACGCCTTTGTTATAATTTTTTTCATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTCCCCCTTATACTTGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAACATAAGATTTTGACTTCTACCCCCCTCTTTAATTCTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTACCCACCCCTCTCTTCCAATATCGCTCACGGAGGAAGATCAGTAGATTTAGCTATTTTCTCACTTCATTTAGCAGGAATTTCATCTATTCTAGGAGCAATTAACTTTATTACCACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCCCTATTTGTATGAGCTGTTGGAATTACAGCATTTTTATTACTTCTTTCACTCCCAGTTTTAGCAGGAGCAATTACTATATTATTAACTGATCGTAATTTAAATACATCATTCTTTGACCCTGCGGGAGGAGGAGATCCTATTTTATACCAACACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Orgyia antiqua

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Specimens with Barcodes: 42
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Orgyia antiqua

The Rusty Tussock Moth or Vapourer, Orgyia antiqua, is a moth in the family Lymantriidae that is native to Europe, but now transcontinental in distribution in the Palaearctic and the Nearctic regions. The orange-brown male flies mostly during the day, but the female is flightless, spending her brief life attached to her cocoon. The hairy caterpillar is spectacular, with "humps", "horns" and a "tail" in a combination of dark grey, red and yellow. It feeds on a wide range of broad-leaved trees and shrubs, and may reach pest proportions in forests and cities.

Description[edit]

The female is flightless and spends her brief adult life clinging to her cocoon
See glossary for terms used

There is a striking dimorphism between the male and the female moths of this species. The male moth typically has orange- to red-brown (ochreous red and dark brown) wings; each forewing has a white comma-shaped (tornal) spot. He has marked plumose (short, bipectinate) antennae. The wingspan measures between 35 and 38 millimetres. The female moth has vestigial wings and is flightless; she is light grey-brown (ochreous grey), has "shortly bipectinate" antennae, and a swollen abdomen (de Worms, 1979; Waring et al., 2003). The caterpillar is distinctive (see images and below).

Range[edit]

Orgyia antiqua is native to Europe, but now has a transcontinental distribution in the Palaearctic and the Nearctic regions (Carter, 2004).

Status[edit]

The species is not on the IUCN (2007) Red List; and in the UK is considered a common resident (Waring et al., 2003).

Habitat[edit]

In the UK, Orgyia antiqua may be encountered in a variety of shrub-based habitats, including gardens, parks, open woodland, fens, hedgerows, heaths and moors (Waring et al., 2003).

Habits[edit]

The male flies in a zigzag pattern—often high up in search of females—and is active during the day or at night. Males occasionally come to light (Waring et al., 2003). In New Brunswick, Canada, adult males are attracted to pheromone traps set in commercial forests for White-marked Tussock Moth (O. leucostigma) (Carter, 2004).

The caterpillar is a minor forest pest in North America (Carter, 2004), and may become a pest in cities in the UK (de Worms, 1979; Porter, 1997).

Life cycle[edit]

Egg[edit]

Egg-mass on empty cocoon on pine species

Several hundred eggs are laid on the outside of the female's empty cocoon, usually attached to a host-plant or something close by (e.g. fence, wall) (Waring et al., 2003). The species over-winters in the egg stage.

Each brownish egg is rounded, somewhat flattened top and bottom. There is a small darker depression in the upperside. (de Worms, 1979)

Caterpillar[edit]

The larvae hatch early in the spring, as soon as foliage starts to appear (de Worms, 1979). They are easily recognized by their horn-like tufts of hair-like setae. There are 4 toothbrush-like tufts along the back, and hair pencils that project from the sides at the front and at the back. The body is dark grey to black, and there are red tubercules along the sides and back. They have defensive glands at the back, and wipe their setae against them to charge them with toxins (Wagner, 2005). They grow to about 30–40 mm, females being considerably larger than males (de Worms, 1979). In the UK, caterpillars can be found between May and early September (Waring et al., 2003).

Pupa[edit]

The pupa forms in a crevice (e.g. in tree bark or fence) inside a silk cocoon. It is glossy black and hairy. (de Worms, 1979)

Imago[edit]

Copulating Orgyia antiqua

The female attracts other males via release of a pheromone, the males find the female via the concentration gradient of the released pheromeone. The female mates and lays her grey-yellow eggs in large numbers on her fine-meshed cocoon. The adult moths don't feed and are therefore granted only a short life. The two (sometimes three) generations fly from May till October; in North America there is only one generation a year (Wagner, 2005). In the UK, there is believed to be one protracted generation, from July to October in the south, and from September to October in the north (de Worms, 1979; Waring et al. 2003).

The males are diurnal, flying during the day, but are occasionally attracted to light (de Worms, 1979).

Host-plants[edit]

They are polyphagous and feed on a wide range of deciduous trees and shrubs, such as birch (Betula), Crataegus, Lime (Citrus), Prunus, Quercus, Rubus, Salix, Tamarix and Vaccinium (Porter, 1997; Wagner, 2005).

In Scotland, the species is almost always found on birch (de Worms, 1979).

Gallery[edit]

See also[edit]

References[edit]

  • Carter, Nelson E. (2004), Status of forest pests in New Brunswick in 2003, Department of Natural Resources, Fredericton, New Brunswick, pp. 7–8. (Available at [1]) 
  • de Worms, C.G.M. (1979), .Lymantriidae. In Heath, J., Emmet, A.M., et al. (Eds.) The Moths and Butterflies of Great Britain and Ireland Vol. 9 Sphingidae–Noctuidae Noctuinae and Hadeninae, Curwen Books, London, UK, p. 70. 
  • IUCN (2007), 2007 IUCN Red List of Threatened Species, <www.iucnredlist.org>. Downloaded on 1 January 2008. 
  • Porter, Jim (1997), The Colour Identification Guide to Caterpillars of the British Isles, Viking, London, p. 80. 
  • Wagner, D.M. (2005), Caterpillars of eastern North America, Princeton University Press. 
  • Waring, Paul; Townsend, Martin; Lewington, Richard (2003), Field Guide to the Moths of Great Britain and Ireland, British Wildlife Publishing, Hook, UK, p. 208. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!