Overview

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Orgyia leucostigma

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCTGGTATAATTGGAACTTCCATAAGATTATTAATTCGAGCAGAATTGGGAAACCCAGGTTCATTAATTGGGAATGATCAAATTTATAATACCATTGTAACTGCTCACGCCTTTGTTATAATTTTTTTCATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTCCCCCTTATACTTGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAACATAAGATTTTGACTTCTACCCCCCTCTTTAATTCTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTACCCACCCCTCTCTTCCAATATCGCTCACGGGGGAAGATCAGTAGATTTAGCTATTTTCTCACTTCATTTAGCAGGAATTTCATCTATTCTAGGAGCAATTAACTTTATTACCACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCCCTATTTGTATGAGCTGTTGGAATTACAGCATTTTTATTACTTCTTTCACTCCCAGTTTTAGCAGGAGCAATTACTATATTATTAACTGATCGTAATTTAAATACATCATTCTTTGACCCTGCGGGAGGAGGAGATCCTATTTTATACCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Orgyia leucostigma

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 34
Specimens with Barcodes: 60
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Orgyia leucostigma

Orgyia leucostigma, the White-marked tussock moth, is a moth in the family Lymantriidae. The caterpillar is very common especially in late summer in eastern North America, as far west as Texas, Colorado, and Alberta.

Contents

Life cycle

There are two or more generations a year in eastern North America (Wagner 2005). They overwinter in the egg stage.

Eggs

Eggs are laid in a single mass over the cocoon of the female, and covered in a froth (Wagner 2005). Up to 300 eggs are laid at a time.

Larvae

The larvae are brightly coloured, with tufts of hair-like setae. The head is bright red, the body has yellow or white stripes, with a black stripe along the middle of the back. There are bright red defensive glands on the hind end of the back. Four white toothbrush-like tufts stand out from the back, and there is a grey-brown hair pencil at the hind end. Touching the hairs will set off an allergic reaction in many humans (Wagner 2005). Young larvae skeletonize the surface of the leaf, while older larvae eat everything except the larger veins (Rose and Lindquist, 1982). They grow to about 35 mm.

Pupae

The caterpillars spin a grayish cocoon in bark crevices and incorporate setae in it (Rose and Lindquist, 1982). The moths emerge after 2 weeks.

Adults

The females have reduced wings and do not leave the vicinity of the cocoon. The males are grey with wavy black lines and a white spot on the forewings. (The vapourer, Orgyia antiqua, is similar but is a rusty colour.) The antennae are very feathery. Moths are found from June to October.

Host plants

The caterpillars may be found feeding on an extremely wide variety of trees, both deciduous and coniferous, including apple, birch, black locust, cherry, elm, fir, hackberry, hemlock, hickory, larch, oak, rose, spruce, chestnut, and willow (Wagner 2005). Defoliating outbreaks are occasionally reported especially on Manitoba maple and elm in urban areas (Rose and Lindquist, 1982). Outbreaks are usually ended by viral disease.

Ecology

The fungus Entomophaga maimaiga was introduced to North America to control the gypsy moth Lymantria dispar. The fungus also infects O. leucostigma (Hajek et al., 2004) and could possibly have an impact in years when E. maimaiga is abundant. Large larvae are mostly attacked by birds, and small larvae mostly disappear during dispersal (Medina and Barbosa, 2002).

Subspecies

  • Orgyia leucostigma leucostigma (South Carolina, from Georgia and Florida to Texas)
  • Orgyia leucostigma intermedia Fitch, 1856 (from Maine and Ontario to Virginia, Alberta and Kansas)
  • Orgyia leucostigma plagiata (Walker, 1855) (Nova Scotia, New Brunswick, Quebec)
  • Orgyia leucostigma oslari Barnes, 1900 (New Mexico, Colorado)
  • Orgyia leucostigma sablensis Niel, 1979 (Sable Island, Canada)

References

  • Hajek AE, Strazanac JS, Wheeler MM, Vermeylen FM, Butler L. 2004. Persistence of the fungal pathogen Entomophaga maimaiga and its impact on native Lymantriidae. Biological Conytrol 30 (2): 466–473.
  • Medina RF, Barbosa P. 2002. Predation of small and large Orgyia leucostigma (J.E. Smith) (Lepidoptera : Lymantriidae) larvae by vertebrate and invertebrate predators. Environmental Entomology 31: 1097–1102.
  • Rose, AH and OH Lindquist. 1982. Insects of eastern hardwood tress. Canadian Forestry service, Forestry Tech Rep 29. Government of Canada, Ottawa. ISBN 0-660-11205-1.
  • Wagner, DM. 2005. Caterpillars of eastern North America. Princeton University Press.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!