Molecular Biology and Genetics

Molecular Biology

Barcode data: Acherontia lachesis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACCTCACTAAGATTATTAATTCGAGCAGAATTAGGTAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCATTTATTATAATTTTCTTTATAGTAATACCAATTATAATTGGTGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCTCCAGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGACTTTTACCCCCCTCTTTATTACTTTTAATTTCTAGTAGTATTGTAGAAAATGGAGCCGGAACAGGATGAACAGTTTATCCCCCACTTTCATCCAATATCGCCCATAGAGGAAGATCAGTAGATTTAGCTATTTTTTCATTACATCTTGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATATATTTTGATCAAATACCCCTATTTGTTTGAGCTGTAGGAATTACAGCATTCTTATTATTATTATCTTTACCAGTATTGGCAGGTGCAATTACCATACTATTAACTGATCGTAATTTAAATACATCTTTCTTCGACCCTGCAGGAGGTGGAGACCCTATTCTTTATCAACACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acherontia lachesis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 36
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Acherontia lachesis

Acherontia lachesis is a large (up to 13 cm wingspan) Sphingid moth found in India and much of the Oriental region, one of the three species of Death's-head Hawkmoth, also known as the Bee Robber. It is nocturnal, and very fond of honey; they can mimic the scent of honey bees so that they can enter a hive unharmed to get honey. Their tongue, which is stout and very strong, enables them to pierce the wax cells and suck the honey out. This species occurs throughout almost the entire Oriental region, from India, Pakistan and Nepal to the Philippines, and from southern Japan and the southern Russian Far East to Indonesia, where it attacks colonies of several different honey bee species. It has recently become established on the Hawaiian Islands.[1]

A live Death's head Hawkmoth from Arunachal Pradesh, India
larva (2) and pupa (2a)of Acherontia lachesis

Development[edit]

Eggs are laid on a variety of hostplants, belonging to the families Solanaceae, Verbenaceae, Fabaceae, Oleaceae, and Bignoniaceae, among others. Mature larvae can attain 125mm long, and occur in green, yellow, and brownish grey color forms (most commonly grey), with oblique body stripes and a prickly tail horn that is curled at the extreme tip. When molested the caterpillar throws the head and anterior segments of the body from side to side, at the same time making a rapidly repeated clicking noise, which appears to be produced by the mandibles. The larva pupates by pushing its head into the earth, burying itself, and making an ovoid chamber about 15 cm below the surface in which it sheds its skin.

Subspecies[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!