Overview

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Pretty much the native range of bald cypress from Maryland southward.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Ecology

Habitat

Comments: Probably any place with substantial bald cypress is probably potential habitat. The cypress sphinx is definitely not restricted to pristine cypress swamps and does occur where bald cypress is mixed with pines and/or hardwoods. Cocoons are often spun on cypress trunks, rather than underground, which allows the caterpillars to avoid drowning and populations species tooccur in habitats with persistent standing water. However populations are not restricted to such places.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Larval foodplant is bald cypress, and probably other species of Taxodium.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Isoparce cupressi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTGGGAACTTCACTAAGTCTTTTAATTCGGGCAGAATTAGGAAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACAATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATGTTAGGGGCCCCTGATATAGCTTTCCCCCGAATAAATAACATAAGATTTTGGCTTCTACCCCCCTCTTTAATACTATTAATTTCTAGTAGTATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTATACCCCCCACTGTCTTCAAATATTGCCCATAGAGGTAGATCTGTTGATCTAGCTATTTTTTCTTTACATTTGGCGGGAATTTCATCAATTTTAGGAGCCATTAATTTTATTACCACAATTATTAATATACGAGTCAACAATATATCATTTGATCAAATACCATTATTTGTTTGAGCTGTAGGTATTACAGCATTTTTATTATTATTATCTTTACCTGTTTTAGCAGGTGCAATTACAATATTATTAACAGACCGAAACTTAAACACATCATTTTTTGATCCGGCTGGAGGGGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Isoparce cupressi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Isoparce cupressi

The Baldcypress Sphinx or Cypress Sphinx (Isoparce cupressi) is a moth of the Sphingidae family. It is found in Cypress swamps in from Maryland to Texas. It has been reported from Mexico.[2]

The wingspan is 60–65 mm. The upperside of the forewing is gray with two longitudinal broken black dashes. The lower dash, with a patch of orange-brown above it, is thicker and is located near the anal angle. The upper broken dash is near the apex. The upperside of the hindwing is dark gray. The outer wing fringes are checkered with white to yellowish gray and black.

There are at least four generations per year in Louisiana with adults on wing from February to October.

The larvae feed on the needles of Taxodium distichum. Pupation takes place in a shallow underground burrow where the second generation overwinters.

References[edit]

  1. ^ "CATE Creating a Taxonomic eScience - Sphingidae". Cate-sphingidae.org. Retrieved 2011-11-01. 
  2. ^ "Silkmoths". Silkmoths.bizland.com. 2007-07-04. Retrieved 2011-11-01. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!