Molecular Biology and Genetics

Molecular Biology

Barcode data: Euryglottis dognini

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTGGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGTACTCCAGGATTATTAATTGGAGATGATCAAATTTATAATACAATTGTAACCGCCCATGCATTTATTATAATTTTTTTTATGGTCATACCCATAATAATCGGGGGATTTGGAAATTGATTAGTCCCCCTAATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTTTTACCCCCCTCTTTGGCTTTATTAATTTCTAGTAGTATTGTGGAAAATGGAGCTGGGACAGGTTGAACTGTATATCCCCCCCTATCCTCTAATATTGCTCATAGAGGAGGCTCTGTTGATTTAGCTATCTTTTCCCTACACTTAGCTGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATTACTACAATTATTAACATACGAATTAATAATATATCATTTGATCAAATACCATTATTTGTTTGAGCTGTGGGAATTACAGCTTTCTTACTATTATTATCTCTACCTGTATTGGCGGGTGCTATTACTATACTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGTGGAGATCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Euryglottis dognini

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Euryglottis dognini

Euryglottis dognini is a moth of the Sphingidae family. It is known from Colombia, Peru, Bolivia and Venezuela.[2]

The wingspan is about 117 mm. There are three rows of white spots on each side of the abdomen and a large white patch at the base on the abdomen underside.

Adults are on wing in February and August.

References[edit]

  1. ^ "CATE Creating a Taxonomic eScience - Sphingidae". Cate-sphingidae.org. Retrieved 2011-11-01. 
  2. ^ "Silkmoths". Silkmoths.bizland.com. Retrieved 2011-11-01. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!