Overview

Comprehensive Description

Description

 Shell up to 5 cm long and 2.5 cm in breadth with sharply pointed apex and 8 tumid whorls. Siphonal canal short, open in juveniles but closed by a flat growth of shelly material in mature shells. Outer lip thin and crenulate in juveniles, thick and coarsely denticulate in older specimens. Ridges across whorls (costae) well spaced, 7-8 on last whorl. Aperture oval. Last whorl with 8-9 spiral ridges. Shell yellowish or white in colour, often with brown markings, especially on costae and spiral ridges. Flesh yellow or cream with white markings. Distinct egg capsules are a flattened vase shape and layed in clumps on stones or shells.In populations subject to high tributyltin (TBT) pollution, female Ocenebra erinacea exhibit a characteristic malformation of the oviduct as an effect of advanced imposex.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 75 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 0 - 96
  Temperature range (°C): 9.788 - 12.348
  Nitrate (umol/L): 2.853 - 6.353
  Salinity (PPS): 34.670 - 35.363
  Oxygen (ml/l): 6.017 - 6.346
  Phosphate (umol/l): 0.333 - 0.682
  Silicate (umol/l): 2.314 - 5.963

Graphical representation

Depth range (m): 0 - 96

Temperature range (°C): 9.788 - 12.348

Nitrate (umol/L): 2.853 - 6.353

Salinity (PPS): 34.670 - 35.363

Oxygen (ml/l): 6.017 - 6.346

Phosphate (umol/l): 0.333 - 0.682

Silicate (umol/l): 2.314 - 5.963
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Predominantly sublittoral, occurring on rocks and under stones to depths of 150 m, but may often be found on the lower parts of sheltered rocky shores in the summer.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ocenebra erinacea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 29 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AGTCTTCTTATTCGAGCTGAATTAGGACAACCGGGGGCTCTATTAGGAGAC---GATCAATTATATAATGTTATTGTAACAGCACACGCTTTTGTGATAATTTTTTTTCTTGTAATGCCGATAATAATTGGAGGATTCGGAAATTGGCTAGTGCCTTTGATACTAGGTGCTCCAGATATAGCTTTTCCACGACTTAATAATATAAGATTCTGGCTTTTACCTCCTGCCCTTTTGCTTTTACTTTCTTCTGCAGCAGTGGAGAGTGGTGTGGGGACAGGTTGAACTGTTTATCCTCCCCTGGCTGGTAACTTGGCTCATGCTGGAGGTTCTGTAGATTTAGCTATTTTTTCATTACACCTAGCAGGGGTTTCATCTATTTTAGGTGCTGTAAATTTTATTACAACTATTATTAACATGCGTTGACGAGGTATGCAGTTTGAGCGTCTTTCTTTATTTGTTTGATCTGTAAAAATTACAGCTGTTTTACTTCTATTATCATTACCTGTATTAGCTGGGGCCATTACTATATTACTAACTGATCGAAACTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ocenebra erinacea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 29
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Ocenebra erinaceus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ocenebra erinaceus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Ocenebra erinacea

Ocenebra erinacea, common name the European sting winkle, is a species of predatory sea snail, a marine gastropod mollusk in the family Muricidae, the murex and rock snails.

The name Ocenebra erinaceus is the accepted name according to the database World Register of Marine Species (WoRMS),[1] and the name is also accepted as valid by the ICZN (Op. 886) [2]

Synonyms[edit source | edit]

  • Cenebra erinacea
  • Murex bicristata Risso, 1826
  • Murex cinguliferus Lamarck, 1822
  • Murex duthiersi Velain, 1877
  • Murex erinaceus Linnaeus, 1758
    • Murex erinaceus var. amirrus de Gregorio, 1885
    • Murex erinaceus var. benisafiensis Koch in Pallary, 1900
    • Murex erinaceus var. conspersa Dautzenberg, 1887
    • Murex erinaceus var. depauperata Dautzenberg, 1887
    • Murex erinaceus var. fasciata Dautzenberg, 1887
    • Murex erinaceus var. fusca Dautzenberg, 1887
    • Murex erinaceus var. major Dautzenberg, 1920
    • Murex erinaceus var. mutica Dautzenberg & Durouchoux, 1913
    • Murex erinaceus var. sculpta Jeffreys, 1867
    • Murex erinaceus var. thersites Coen, 1933
    • Murex erinaceus var. triquetra Coen, 1933
    • Murex erinaceus var. venetiana de Gregorio in Coen, 1933
    • Murex erinaceus var. viriditincta Dautzenberg & Fischer, 1925
  • Murex hanleyi Dautzenberg, 1887
  • Murex imbricatus Chiereghini in Nardo, 1847
  • Murex labiosus Chiereghini in Nardo, 1847
  • Murex orbignyanus Risso, 1826
  • Murex pirotectus de Gregorio, 1885
  • Murex tarantinus Lamarck, 1822
  • Murex triquetra Risso, 1826
  • Murex ungulatus Chiereghini in Nardo, 1847
    • Ocenebra erinaceus elongatus Settepassi, 1970
    • Ocenebra erinaceus var. africanus Settepassi, 1970
    • Ocenebra erinaceus var. algerianus Settepassi, 1970
    • Ocenebra erinaceus var. candida Dautzenberg, 1894
    • Ocenebra erinaceus var. carneola Dautzenberg & Durouchoux, 1913
    • Ocenebra erinaceus var. dilatatus Settepassi, 1970
    • Ocenebra erinaceus var. foliosa Monterosato in Coen, 1914
    • Ocenebra erinaceus var. ibericus Settepassi, 1970
    • Ocenebra erinaceus var. neglectus Settepassi, 1970
    • Ocenebra erinaceus var. pagodulinus Settepassi, 1970
    • Ocenebra erinaceus var. producta Dautzenberg & Durouchoux, 1913
    • Ocenebra erinaceus var. solidus Settepassi, 1970
    • Ocenebra erinaceus var. squamulosus Philippi in Settepassi, 1970
    • Ocenebra gibbosus var. acuminatus Settepassi, 1970
    • Ocenebra gibbosus var. compositus Settepassi, 1970
    • Ocenebra gibbosus var. elongatus Settepassi, 1970
  • Ocinebra labiosus (Chiereghini in Nardo, 1847)
    • Ocinebra labiosus var. fasciata Coen, 1933
  • Purpura congener Roding, 1798
  • Purpura senegalla Roding, 1798
  • Tritonalia chicoroides Coen, 1947
  • Tritonalia erinaceus (Linnaeus, 1758)
    • Tritonalia erinaceus var. clathrata Coen, 1947
  • Tritonalia humilis Coen, 1947
  • Tritonalia lampusiopsis Coen, 1947
  • Tritonalia mercaensis Coen, 1947
  • Tritonalia rejecta Monterosato in Coen, 1947
  • Tritonalia rotunda Coen, 1947
  • Tritonalia ruscuriana Monterosato in Coen, 1947

References[edit source | edit]

  1. ^ WoRMS : Ocenebra erinaceus
  2. ^ Backeljau, T. (1986). Lijst van de recente mariene mollusken van België [List of the recent marine molluscs of Belgium]. Koninklijk Belgisch Instituut voor Natuurwetenschappen: Brussels, Belgium. 106 pp.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!