Overview

Comprehensive Description

The shell of Urosalpinx cinerea is knobby having rugged whorls (turns of the shell) with rounded shoulders usually numbering 5. Each complete turn of the Atlantic oyster has 9-12 vertical, rounded ribs crossed with 15 rows of thinner spiral ridges. The aperture (opening through which the snail moves in and out of the shell) of U. cinerea is oval with an open canal at the base. Shells are usually yellow sometimes orange, grey or white and occasionally bearing brown streaks. The interior of the shell can be purple, red-brown or yellow. The operculum (the plate that closes to protect the snail when it is inside its shell) can be orange or yellow-brown.U. cinerea, a mollusk in the family Muricidae, is considered a major pest among the world's bivalve fisheries (Robinson and Dillon 2008). In colder waters, this species will be dormant throughout the winter and emerge in April to feed (Franz 1971).
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Brusca RC and GJ Brusca. 1990. Invertebrates. Sinauer Associates, Inc. Sunderland, MA pp. 731.
  • Faasse M and M Ligthart. 2007. The America oyster drill, Urosalpinx cinerea (Say, 1822), introduced to The Netherlands - increased risks after ban on TBT. Aquatic Invasions 2:402-406.
  • Franz DR 1971. Population age structure, growth and longevity of the marine gastropod Urosalpinx cinerea Say. Biological Bulletin 140:63-72.
  • Ganaros AE. 1958. On developments of early stages of Urosalpinx cinerea (Say) at constant temperatures and their tolerance to low temperatures. Biological Bulletin 114:188-195.
  • Gibbs PE, Spenser BE, and PL Pascoe. 1991. The American oyster drill, Urosalpinx cinerea (Gastropoda): Evidence of decline in an imposex-affected population (R. Blackwater, Essex). Journal of the Marine Biological Association of the United Kingdo, Plymouth. 71:827-838.
  • Guide to the Exotic Species of San Francisco Bay. Available online.
  • Hanks JE. 1957. The feeding rates of the common oyster drill, Urosalpinx cinerea (Say), at controlled water temperatures. Biological Bulletin 112:330-335.
  • Manzi JJ. 1970. Combined effects of salinity and temperature on the feeding, reproductive, and survival rates of Eupleura caudate (Say) and Urosalpinx cinerea (Say) (Prosobranchia: Muricidae). Biological Bulletin 138:35-46.
  • Minchin D. 1996. Management of the introduction and transfer of marine molluscs. Aquatic Conservation: Marine and Freshwater Ecosystems 6:229-244.
  • Ritchoff D, Williams LG, Brown B, and MR Carriker. 1983. Chemical attraction of newly hatched oyster drills. Biological Bulletin 164:493-505.
  • Robinson JD and RT Dillon, Jr. 2008. Genetic divergence among sympatric populations of three species of oyster drills (Urosalpinx) in Cedar Key, Florida. Bulletin of Marine Science 82:19-31.
  • Zachary A and DS Haven. 2004. Survival and activity of the oyster drill Urosalpinx cinerea under conditions of fluctuating salinity. Marine Biology 22:45-52.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 The shell of Urosalpinx cinerea is tall and conical with a sharply pointed spire. There are 7-8 whorls. The last whorl has with 10-12 ridges across the whorl and 16-18 prominent spiral lengthway ridges. The shell is yellowish or grey, sometimes with irregular brown marks. The shell is up to 4 cm high and 2 cm broad. The last whorl occupies about 70% of the shell height and the aperture 45-50%.The oval shell aperture has a thin and crenullate outer lip. The external features of the animal are similar to the dog whelk Nucella lapillus. The body is cream with dark markings on the tentacles and mantle edge. The head tentacles are flattened with eyes at the junction with the broader base. The foot is similar to Nucella lapillus.Urosalpinx cinerea was an unintentional introduction with American oysters Crassostrea virginica. It has limited adult mobility and the lack of a free-swimming larval stage prevents it spreading quickly. It was severely affected by tributyl tin (TBT) pollution. Urosalpinx cinerea predates native oysters and commercial oyster beds. It feeds by boring through oyster shells. The eggs of Urosalpinx cinerea are laid in capsules attached to oyster shells or stones. Each capsule has about 12 eggs, most of which hatch as juveniles. Urosalpinx cinerea resembles Ocenebra erinacea but the siphonal aperture is closed in Ocenebra erinacea and the shell is rough with uneven sculpturing. Urosalpinx cinerea also has a broader and fatter shell.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Urosalpinx cinerea is found along the Eastern shore of the United States from the coast of Florida to Massachusetts Bay. Urosalpinx cinerea can also be found along the coast of Great Britain. (Pratt, 1916 ; Nichols & Cooke, 1979 ; JNCC, 1998)

Biogeographic Regions: atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range: 46°N to 27.7°N; 81°W to 64°W. Distribution: Canada; Canada: Gulf of St. Lawrence; USA: New Hampshire, Massachusetts, New York, New Jersey, Maryland, Virginia, North Carolina, South Carolina, Georgia, Florida; Florida: East Florida
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic Europe, Bay of Fundy, Cobscook Bay, East Coast of England, European waters (ERMS scope), Gulf of Maine, Irish Exclusive economic Zone, Minas Basin, North Sea, North West Atlantic, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The natural range of Urosalpinx cinerea is northwestern Atlantic to southeastern Florida. The mode of development of U. cinerea naturally limits its population range (Minchin 1996). Human transport in ballast water of ships and in seed beds of its bivalve prey have introduced this voracious muricid gastropod to the Gulf of Mexico, the Pacific coast of the United States, and the eastern north Atlantic (Robinson and Dillon 2008). The Atlantic oyster drill occurs in intertidal and shallow subtidal waters in estuaries and bays to a maximum depth of approximately 15 m and is common on rocks and oyster reefs (Franz 1971). Urosalpinx cinerea inhabits oyster reefs (Crassostrea virginica) of the Indian River Lagoon.
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Brusca RC and GJ Brusca. 1990. Invertebrates. Sinauer Associates, Inc. Sunderland, MA pp. 731.
  • Faasse M and M Ligthart. 2007. The America oyster drill, Urosalpinx cinerea (Say, 1822), introduced to The Netherlands - increased risks after ban on TBT. Aquatic Invasions 2:402-406.
  • Franz DR 1971. Population age structure, growth and longevity of the marine gastropod Urosalpinx cinerea Say. Biological Bulletin 140:63-72.
  • Ganaros AE. 1958. On developments of early stages of Urosalpinx cinerea (Say) at constant temperatures and their tolerance to low temperatures. Biological Bulletin 114:188-195.
  • Gibbs PE, Spenser BE, and PL Pascoe. 1991. The American oyster drill, Urosalpinx cinerea (Gastropoda): Evidence of decline in an imposex-affected population (R. Blackwater, Essex). Journal of the Marine Biological Association of the United Kingdo, Plymouth. 71:827-838.
  • Guide to the Exotic Species of San Francisco Bay. Available online.
  • Hanks JE. 1957. The feeding rates of the common oyster drill, Urosalpinx cinerea (Say), at controlled water temperatures. Biological Bulletin 112:330-335.
  • Manzi JJ. 1970. Combined effects of salinity and temperature on the feeding, reproductive, and survival rates of Eupleura caudate (Say) and Urosalpinx cinerea (Say) (Prosobranchia: Muricidae). Biological Bulletin 138:35-46.
  • Minchin D. 1996. Management of the introduction and transfer of marine molluscs. Aquatic Conservation: Marine and Freshwater Ecosystems 6:229-244.
  • Ritchoff D, Williams LG, Brown B, and MR Carriker. 1983. Chemical attraction of newly hatched oyster drills. Biological Bulletin 164:493-505.
  • Robinson JD and RT Dillon, Jr. 2008. Genetic divergence among sympatric populations of three species of oyster drills (Urosalpinx) in Cedar Key, Florida. Bulletin of Marine Science 82:19-31.
  • Zachary A and DS Haven. 2004. Survival and activity of the oyster drill Urosalpinx cinerea under conditions of fluctuating salinity. Marine Biology 22:45-52.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Urosalpinx cinerea is about 25mm long and 15mm wide. Its flesh is of a gray or yellowish color with brown spiral stripes. Its shell resembles that of the common Ocenebra but is smaller, darker, and less ridged. Its shell is fusiform and has a rough texture created by an average of 12 ridges running longitudinal along the shell. The shell is also characterized by 5 to 6 raised whorls. The lip of the shell typically has between 2 and 6 teeth and is scalloped along with a short aperture with a canal. The species seems to be monomorphic and there is no difference in appearance depending upon the season. There also seems to be no reported or observed polymorphisms. Young members of the species seem to only differ from adults in relative size including length and mass. (Pratt, 1916 ; Nichols & Cooke, 1979)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Urosalpinx cinerea live 5-8 years and reach sexual maturity in 2 years when they reach approximately 16mm in length. The shell size of the Atlantic oyster drill is reported to vary among populations (Franz 1971). Populations in England are reported to be larger than the eastern Atlantic. On the Pacific coast, this gastropod is recorded to grow to 30-35 mm in length. In this same population, female specimens were recorded at larger sizes than their male counterpart. Variation in growth rate, span of time during growth, and diet may account for these observations (Franz 1971).
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Brusca RC and GJ Brusca. 1990. Invertebrates. Sinauer Associates, Inc. Sunderland, MA pp. 731.
  • Faasse M and M Ligthart. 2007. The America oyster drill, Urosalpinx cinerea (Say, 1822), introduced to The Netherlands - increased risks after ban on TBT. Aquatic Invasions 2:402-406.
  • Franz DR 1971. Population age structure, growth and longevity of the marine gastropod Urosalpinx cinerea Say. Biological Bulletin 140:63-72.
  • Ganaros AE. 1958. On developments of early stages of Urosalpinx cinerea (Say) at constant temperatures and their tolerance to low temperatures. Biological Bulletin 114:188-195.
  • Gibbs PE, Spenser BE, and PL Pascoe. 1991. The American oyster drill, Urosalpinx cinerea (Gastropoda): Evidence of decline in an imposex-affected population (R. Blackwater, Essex). Journal of the Marine Biological Association of the United Kingdo, Plymouth. 71:827-838.
  • Guide to the Exotic Species of San Francisco Bay. Available online.
  • Hanks JE. 1957. The feeding rates of the common oyster drill, Urosalpinx cinerea (Say), at controlled water temperatures. Biological Bulletin 112:330-335.
  • Manzi JJ. 1970. Combined effects of salinity and temperature on the feeding, reproductive, and survival rates of Eupleura caudate (Say) and Urosalpinx cinerea (Say) (Prosobranchia: Muricidae). Biological Bulletin 138:35-46.
  • Minchin D. 1996. Management of the introduction and transfer of marine molluscs. Aquatic Conservation: Marine and Freshwater Ecosystems 6:229-244.
  • Ritchoff D, Williams LG, Brown B, and MR Carriker. 1983. Chemical attraction of newly hatched oyster drills. Biological Bulletin 164:493-505.
  • Robinson JD and RT Dillon, Jr. 2008. Genetic divergence among sympatric populations of three species of oyster drills (Urosalpinx) in Cedar Key, Florida. Bulletin of Marine Science 82:19-31.
  • Zachary A and DS Haven. 2004. Survival and activity of the oyster drill Urosalpinx cinerea under conditions of fluctuating salinity. Marine Biology 22:45-52.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Urosalpinx cinerea usually dwell on rocks or in the sand along the coast and in bays. (Nichols & Cooke, 1979) Urosalpinx cinerea is found anywhere oysters flourish. They are most abundent in intertidal zones and shallow water areas including estuaries, marshes, and bays. Urosalpinx cinerea especially enjoys these waters when there is a relatively high salinity content. Usually, the greater the salinity content the more this species will thrive at a specific location. (Beal, 1993 ; NOAA, 2000)

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

infralittoral and circalittoral of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 190 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 0.3 - 61
  Temperature range (°C): 9.208 - 23.636
  Nitrate (umol/L): 0.325 - 3.829
  Salinity (PPS): 32.282 - 35.785
  Oxygen (ml/l): 4.855 - 6.764
  Phosphate (umol/l): 0.110 - 0.547
  Silicate (umol/l): 0.756 - 3.154

Graphical representation

Depth range (m): 0.3 - 61

Temperature range (°C): 9.208 - 23.636

Nitrate (umol/L): 0.325 - 3.829

Salinity (PPS): 32.282 - 35.785

Oxygen (ml/l): 4.855 - 6.764

Phosphate (umol/l): 0.110 - 0.547

Silicate (umol/l): 0.756 - 3.154
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Found on the lower shore and sublittoral to a depth of about 12 m, feeding especially on oysters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Food usually consists of oysters and other mollusks. This makes Urosalpinx cinerea a carnivore. It prefers to prey upon smaller softer shelled oysters, which are much easier to penetrate and eat. They are usually stationary or somewhat mobile filter feeders that remain in set stationary breeding or living beds located on the floor of the shoreline. Urosalpinx cinerea crawls over the beds finding small oysters. It then grips the shell with its foot, which secretes a softening agent and uses its drill, called a radula, in a mechanical process to break through the prey's shell. Once this occurs Urosalpinx cinerea inserts its proboscis into the oyster, which then secretes a muscle relaxer into the prey causing the oyster to open exposing the animal inside. (Morton, 1958 ; Buchsbaum & Pearse, 1987 ; Nichols & Cooke, 1979)

After drilled, a total of one fourth of the oyster's tissue remains inside. This tissue consists of the adductor muscle, various soft parts, and the gills. The muscle destruction of the oysters caused by the drill was found to range from none to total destruction. However, it was found that in 90% of the oysters studied, at least half of the adductor muscle was destroyed. The oyster drills exhibited a clear preference when eating consisting of various soft tissues, the gills, and the adductor muscle allowing the oyster drills to eat as long as possible on one oyster before it gapes allowing other predators to feed upon it. Urosalpinx cinerea drills the oysters through the central portion of the valve and not at the margin of the valves. (Chapman, 1955)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Atlantic oyster drill preys upon oysters, barnacles and other bivalves including mussels. Young snails feed on bryozoans, ectoprocts, small snails and barnacles. In San Francisco Bay, the preferred prey is reported to be young barnacle and clams. In the mid-Atlantic, the barnacle Balanus balanoides and the mussel Mytilis edulis are the preferred prey (Franz 1971). Adults are reported to use a chemical cue released from the prey to locate suitable feeding habitats (Ritchoff et al. 1983). In laboratory experiments with newly hatched juveniles that were not previously exposed to prey species, Urosalpinx cinerea preferentially migrated upstream toward çodorsç from living barnacles.The gastropod bores a hole through the shell of its prey with a file-like rasping organ called a radula and produces acidic chemical secretions from a boring gland that soften the shell. U. cinerea then insert its proboscis to get to the prey's soft tissue (Brusca and Brusca 1990). The Atlantic oyster shell is a voracious predator and has the potential to be one of the most destructive predators of young oysters (Ganaros 1958). Competitors: Competitors of the ornate blue crab are other crustaceans, in particular C. sapidus and C. similis. INVASION INFORMATIONInvasion History: Urosalpinx cinerea is an invasive species in many parts of the world, and has been introduced to several new regions by human transport by ship and other means. It was first found on the Pacific coast of the United States and Canada in the late 1800's introduced in shipments of imported Crassostrea virginica. The American oyster drill was introduced to the United Kingdom in shipments of C. virginica at the turn of the century. In this region, it has been reported from Essex and Kent in southeast Britain (Faasse and Ligthart 2007). Tributyltin (TBT) has been an effective control in the southeast Britain populations causing imposex in the females, a maculizing syndrome inhibiting reproductive processes (Gibbs et al. 1991). More recently following the ban of TNT in 1993, U. cinerea was reported from The Netherlands. It is suspected that U. cinerea may have been introduced in seed mussels imported from Sussex and Kent. Invasion History: Urosalpinx cinerea poses a major concern because they usually thrive in their new habitat without specialized predators and parasites (Faasse and Ligthart 2007). Invasion History: Damage to the oyster bed fisheries around the world has been estimated to be in the millions of dollars per year (Manzi 1970).
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Brusca RC and GJ Brusca. 1990. Invertebrates. Sinauer Associates, Inc. Sunderland, MA pp. 731.
  • Faasse M and M Ligthart. 2007. The America oyster drill, Urosalpinx cinerea (Say, 1822), introduced to The Netherlands - increased risks after ban on TBT. Aquatic Invasions 2:402-406.
  • Franz DR 1971. Population age structure, growth and longevity of the marine gastropod Urosalpinx cinerea Say. Biological Bulletin 140:63-72.
  • Ganaros AE. 1958. On developments of early stages of Urosalpinx cinerea (Say) at constant temperatures and their tolerance to low temperatures. Biological Bulletin 114:188-195.
  • Gibbs PE, Spenser BE, and PL Pascoe. 1991. The American oyster drill, Urosalpinx cinerea (Gastropoda): Evidence of decline in an imposex-affected population (R. Blackwater, Essex). Journal of the Marine Biological Association of the United Kingdo, Plymouth. 71:827-838.
  • Guide to the Exotic Species of San Francisco Bay. Available online.
  • Hanks JE. 1957. The feeding rates of the common oyster drill, Urosalpinx cinerea (Say), at controlled water temperatures. Biological Bulletin 112:330-335.
  • Manzi JJ. 1970. Combined effects of salinity and temperature on the feeding, reproductive, and survival rates of Eupleura caudate (Say) and Urosalpinx cinerea (Say) (Prosobranchia: Muricidae). Biological Bulletin 138:35-46.
  • Minchin D. 1996. Management of the introduction and transfer of marine molluscs. Aquatic Conservation: Marine and Freshwater Ecosystems 6:229-244.
  • Ritchoff D, Williams LG, Brown B, and MR Carriker. 1983. Chemical attraction of newly hatched oyster drills. Biological Bulletin 164:493-505.
  • Robinson JD and RT Dillon, Jr. 2008. Genetic divergence among sympatric populations of three species of oyster drills (Urosalpinx) in Cedar Key, Florida. Bulletin of Marine Science 82:19-31.
  • Zachary A and DS Haven. 2004. Survival and activity of the oyster drill Urosalpinx cinerea under conditions of fluctuating salinity. Marine Biology 22:45-52.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Urosalpinx cinerea is prey of:
Callinectes sapidus

Based on studies in:
USA: New Jersey (Brackish water)

This list may not be complete but is based on published studies.
  • C. H. Peterson, The importance of predation and competition in organizing the intertidal epifaunal communities of Barnegat Inlet, New Jersey, Oecologia (Berlin) 39:1-24, from p. 8 (1979).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Urosalpinx cinerea preys on:
Balanus balanoides
Balanus eburneus
Modiolus demissus
Littorina littorea

Based on studies in:
USA: New Jersey (Brackish water)

This list may not be complete but is based on published studies.
  • C. H. Peterson, The importance of predation and competition in organizing the intertidal epifaunal communities of Barnegat Inlet, New Jersey, Oecologia (Berlin) 39:1-24, from p. 8 (1979).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Populations of the Atlantic oyster drill can be very dense ranging between 10 - 100 individuals per square meter (Ritchoff et al. 1983).
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Brusca RC and GJ Brusca. 1990. Invertebrates. Sinauer Associates, Inc. Sunderland, MA pp. 731.
  • Faasse M and M Ligthart. 2007. The America oyster drill, Urosalpinx cinerea (Say, 1822), introduced to The Netherlands - increased risks after ban on TBT. Aquatic Invasions 2:402-406.
  • Franz DR 1971. Population age structure, growth and longevity of the marine gastropod Urosalpinx cinerea Say. Biological Bulletin 140:63-72.
  • Ganaros AE. 1958. On developments of early stages of Urosalpinx cinerea (Say) at constant temperatures and their tolerance to low temperatures. Biological Bulletin 114:188-195.
  • Gibbs PE, Spenser BE, and PL Pascoe. 1991. The American oyster drill, Urosalpinx cinerea (Gastropoda): Evidence of decline in an imposex-affected population (R. Blackwater, Essex). Journal of the Marine Biological Association of the United Kingdo, Plymouth. 71:827-838.
  • Guide to the Exotic Species of San Francisco Bay. Available online.
  • Hanks JE. 1957. The feeding rates of the common oyster drill, Urosalpinx cinerea (Say), at controlled water temperatures. Biological Bulletin 112:330-335.
  • Manzi JJ. 1970. Combined effects of salinity and temperature on the feeding, reproductive, and survival rates of Eupleura caudate (Say) and Urosalpinx cinerea (Say) (Prosobranchia: Muricidae). Biological Bulletin 138:35-46.
  • Minchin D. 1996. Management of the introduction and transfer of marine molluscs. Aquatic Conservation: Marine and Freshwater Ecosystems 6:229-244.
  • Ritchoff D, Williams LG, Brown B, and MR Carriker. 1983. Chemical attraction of newly hatched oyster drills. Biological Bulletin 164:493-505.
  • Robinson JD and RT Dillon, Jr. 2008. Genetic divergence among sympatric populations of three species of oyster drills (Urosalpinx) in Cedar Key, Florida. Bulletin of Marine Science 82:19-31.
  • Zachary A and DS Haven. 2004. Survival and activity of the oyster drill Urosalpinx cinerea under conditions of fluctuating salinity. Marine Biology 22:45-52.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

The breeding season begins once the water temperature drops down into the 20s C and remains there for a week. The eggs are fertilized and deposited between rocks or on the floor of the ocean. The eggs are usually 240 microns in diameter. When the eggs are deposited with an albuminus substance that provides nourishment for the development of embryos. The cleavage of the egg is unequal and spiral with large polar lobes. The hatching embryo produces an enzyme that dissolves the protective sack. The average time it takes for an embryo to develop from fertilization to hatching is 40 days. The embryonic development itself is related to that of other gastropods. The veliger is formed at an early stage of development. Next, the foot appears and is formed before the blastopore closes. At this point, both the velum and the shell are well developed. The anus and intestinal track are late in forming. The velum is lost and the young snail emerges as a well-formed snail. (Costello & Henley, 2000)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Urosalpinx cinerea spawns in spring and summer. Each female attaches approximately 20-40 leathery vase-shaped egg capsules to a hard surface. The capsule is transparent and half of centimeter in height (Franz 1971, Robinson and Dillon 2008).
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Brusca RC and GJ Brusca. 1990. Invertebrates. Sinauer Associates, Inc. Sunderland, MA pp. 731.
  • Faasse M and M Ligthart. 2007. The America oyster drill, Urosalpinx cinerea (Say, 1822), introduced to The Netherlands - increased risks after ban on TBT. Aquatic Invasions 2:402-406.
  • Franz DR 1971. Population age structure, growth and longevity of the marine gastropod Urosalpinx cinerea Say. Biological Bulletin 140:63-72.
  • Ganaros AE. 1958. On developments of early stages of Urosalpinx cinerea (Say) at constant temperatures and their tolerance to low temperatures. Biological Bulletin 114:188-195.
  • Gibbs PE, Spenser BE, and PL Pascoe. 1991. The American oyster drill, Urosalpinx cinerea (Gastropoda): Evidence of decline in an imposex-affected population (R. Blackwater, Essex). Journal of the Marine Biological Association of the United Kingdo, Plymouth. 71:827-838.
  • Guide to the Exotic Species of San Francisco Bay. Available online.
  • Hanks JE. 1957. The feeding rates of the common oyster drill, Urosalpinx cinerea (Say), at controlled water temperatures. Biological Bulletin 112:330-335.
  • Manzi JJ. 1970. Combined effects of salinity and temperature on the feeding, reproductive, and survival rates of Eupleura caudate (Say) and Urosalpinx cinerea (Say) (Prosobranchia: Muricidae). Biological Bulletin 138:35-46.
  • Minchin D. 1996. Management of the introduction and transfer of marine molluscs. Aquatic Conservation: Marine and Freshwater Ecosystems 6:229-244.
  • Ritchoff D, Williams LG, Brown B, and MR Carriker. 1983. Chemical attraction of newly hatched oyster drills. Biological Bulletin 164:493-505.
  • Robinson JD and RT Dillon, Jr. 2008. Genetic divergence among sympatric populations of three species of oyster drills (Urosalpinx) in Cedar Key, Florida. Bulletin of Marine Science 82:19-31.
  • Zachary A and DS Haven. 2004. Survival and activity of the oyster drill Urosalpinx cinerea under conditions of fluctuating salinity. Marine Biology 22:45-52.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

Atlantic oyster drill eggs develop directly into benthic juveniles, skipping a pelagic stage (Robinson and Dillon 2008). Newly emerged juveniles migrate to their food source. In a mid-Atlantic population, first season specimens were reported to associate closely with ectoprocts (Franz 1971). Most shell growth in Urosalpinx cinerea occurs in the first two seasons before the snail matures.
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Brusca RC and GJ Brusca. 1990. Invertebrates. Sinauer Associates, Inc. Sunderland, MA pp. 731.
  • Faasse M and M Ligthart. 2007. The America oyster drill, Urosalpinx cinerea (Say, 1822), introduced to The Netherlands - increased risks after ban on TBT. Aquatic Invasions 2:402-406.
  • Franz DR 1971. Population age structure, growth and longevity of the marine gastropod Urosalpinx cinerea Say. Biological Bulletin 140:63-72.
  • Ganaros AE. 1958. On developments of early stages of Urosalpinx cinerea (Say) at constant temperatures and their tolerance to low temperatures. Biological Bulletin 114:188-195.
  • Gibbs PE, Spenser BE, and PL Pascoe. 1991. The American oyster drill, Urosalpinx cinerea (Gastropoda): Evidence of decline in an imposex-affected population (R. Blackwater, Essex). Journal of the Marine Biological Association of the United Kingdo, Plymouth. 71:827-838.
  • Guide to the Exotic Species of San Francisco Bay. Available online.
  • Hanks JE. 1957. The feeding rates of the common oyster drill, Urosalpinx cinerea (Say), at controlled water temperatures. Biological Bulletin 112:330-335.
  • Manzi JJ. 1970. Combined effects of salinity and temperature on the feeding, reproductive, and survival rates of Eupleura caudate (Say) and Urosalpinx cinerea (Say) (Prosobranchia: Muricidae). Biological Bulletin 138:35-46.
  • Minchin D. 1996. Management of the introduction and transfer of marine molluscs. Aquatic Conservation: Marine and Freshwater Ecosystems 6:229-244.
  • Ritchoff D, Williams LG, Brown B, and MR Carriker. 1983. Chemical attraction of newly hatched oyster drills. Biological Bulletin 164:493-505.
  • Robinson JD and RT Dillon, Jr. 2008. Genetic divergence among sympatric populations of three species of oyster drills (Urosalpinx) in Cedar Key, Florida. Bulletin of Marine Science 82:19-31.
  • Zachary A and DS Haven. 2004. Survival and activity of the oyster drill Urosalpinx cinerea under conditions of fluctuating salinity. Marine Biology 22:45-52.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Urosalpinx cinerea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AGTCTTTTAATTCGAGCTGAATTAGGACAGCCTGGGGCTTTATTAGGAGAC---GACCAGTTATATAATGTTATTGTAACAGCACATGCTTTTGTAATAATTTTTTTTCTTGTAATACCAATAATAATTGGTGGATTTGGGAACTGATTAGTACCTTTAATATTAGGTGCTCCAGATATAGCTTTTCCACGACTTAATAATATAAGATTTTGACTCTTACCTCCTGCTCTCTTACTTTTACTTTCTTCTGCAGCAGTAGAAAGGGGAGTAGGTACAGGTTGGACTGTATACCCCCCATTAGCTGGTAATTTAGCACATGCTGGAGGATCTGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGAGTTTCATCTATTTTAGGTGCAGTAAATTTTATTACAACTATTATTAATATGCGTTGACGAGGGATGCAATTTGAACGCCTTCCTTTATTTGTATGATCTGTAAAAATTACAGCTATTTTACTTCTTTTGTCATTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATCGAAATTTTAATACGGCTTTTTTTGACCCAGCAGGTGGTGGTGATCCAATTTTATATCAACATTTATTTTGATTTTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Urosalpinx cinerea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Urosalpinx cinerea is a natural predator for Eastern Oysters as well as other mollusks. It especially prefers soft-shelled young oysters and tends to eat numerous small meals instead of one larger one. Therefore, the species can become a real pest in commercial oyster areas killing off large numbers of young oysters reducing the amount of harvestable oysters in the succeeding years. This carnivore kills on average 60% or more of the seed crop annually. (Nichols & Cooke, 1979 ; Buchsbaum & Pearse, 1987 ; Gosner, 1979)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Urosalpinx cinerea

Urosalpinx cinerea, common name the eastern or Atlantic oyster drill, is a species of small predatory sea snail, a marine gastropod mollusk in the family Muricidae, the murexes or rock snails.

This species is a serious problem in commercial oyster beds, and it has been accidentally introduced well outside its natural range.

Contents

Distribution

This snail is endemic to the Atlantic coast of North America, from Nova Scotia to Florida. It has been accidentally introduced with oyster spat to Northern Europe and to the West Coast of North America from California to Washington.[1]

Habitat

This species lives from low tide down to a depth of 25 feet.

Life habits

As indicated by its common name, this predatory snail drills through the shells of living oysters and consumes them.

Human relevance

This snail is a serious problem in commercial oyster farming:

"Next to the sea star, this snail is the worst enemy the ... [oyster fisher men] ... have to contend with. ...Settling upon a young bivalve, the oyster drill quickly bores a neat round hole through a valve, making expert use of its sandpaperlike radula. Through this perforation the oyster drill is able to insert its long proboscis and consume the soft parts of the oyster."[2]

Advocates of making use of bycatch, rather than discarding it, have promoted the oyster drill as a food, similar to escargot.[3]

References

  1. ^ Abbott, R. Tucker, 1986. Seashells of North America, St. Martin's Press, New York.
  2. ^ Abbott, R. Tucker; Violet French Morris (1995). Shells of the Atlantic and Gulf Coasts. Houghton Mifflin Co.. pp. 211. http://books.google.com/books?vid=ISBN0618164391&id=Jpk_EKysBxwC&pg=RA62-PA211&lpg=RA62-PA211&ots=eC66l7Vn7r&dq=oyster+drill&sig=qJYI6I4_lsaSm_ixtnerWjbX5d0.
  3. ^ Engelhardt, Elizabeth, "An Oyster by Any Other Name", Southern Spaces, 18 April 2011
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!