Overview

Brief Summary

Taxon Biology

The genus Conus includes more than 500 species of marine snails, all of which are venomous predators. These snails inject venom into their prey by harpooning them with a disposable hollow tooth through which the venom is channeled (Olivera et al. 1990; Olivera 2002).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Conus occurs throughout the tropical and subtropical oceans but is most diverse in the Indo-West Pacific region (The Conus Biodiversity Website, http://biology.burke.washington.edu/conus/index.php). Of the roughly 500 extant Conus species, more than 300 are found in the Indo-Pacific tropics (Kohn 2001). In a study in Papua New Guinea, Kohn (2001) found the numbers of co-occurring Conus species exceeded those of any other known reefs by a factor of one-third or more. Kohn notes that the northeast coast of Papua New Guinea is known to be a biodiversity "hot spot" for many groups of marine benthic invertebrates (Kohn 2001 and references therein).

Although most Conus species have tropical or subtropical distributions, there are a few temperate species (Olivera 2002). Conus californicus, for example, is endemic to the North American Pacific coast (Stewart and Gilly 2005).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Physical Description

Morphology

There are anatomical and physiological differences between the major groups of cone snails as a result of their different feeding mechanisms. However, in general, all cone snails have an elongated tube known as a siphon, which they use to detect the environment around them. Their venom is produced in the tubular venom duct and expelled into the proboscis by the contraction of a muscular bulb at the basal end of the venom duct. The proboscis also contains a radular tooth which is used as both a harpoon and disposable hypodermic needle through which the venom is delivered to the prey. Once the venom has been injected, the prey is immobilized almost instantaneously and engulfed by the cone snail (Halai and Craik 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Kohn (1983) investigated the microhabitat factors affecting Conus abundance and diversity on coral reefs. He concluded that the portions of reefs most favorable for Conus have >20% cover of algal-bound sand and <20% living coral. The former microhabitat offers diurnal shelter and dense prey populations. Living coral, in contrast, harbors few suitable prey organisms and, in fact, contact with it elicits a strong avoidance response by Conus (Kohn 1983).

Most familiar Conus species live in relatively shallow waters, but many (probably including many still undescribed species) live below 150 m (Olivera 2002).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 2 taxa.

Environmental ranges
  Depth range (m): 3 - 3
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Ecology

Conus snails are among the major predators in tropical reef communities and have adapted to nearly every type of tropical marine habitat (Olivera et al. 1990). Although most Conus species prey on only a few (or even a single) species, collectively, they feed on at least four or five different phyla. One group of species feeds only on other mollusks; several hundred other species kill and eat marine worms (mainly polychaetes, but also echiuroids and hemichordates). The 50 or so species that are specialized on killing and eating fishes (first described by A.J. Kohn (1956)) are the only snails known to kill and eat vertebrates (Olivera et al 1990). Conus californicus is unusual in that it has a very broad diet, as well as a temperate distribution (Stewart and Gilly 2005).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Sexes are separate in Conus and the male has an extendable penis (Kohn 1959).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Evolution

Systematics and Taxonomy

Duda et al. (2001) undertook a molecular phylogenetic study of Conus to address the evolution of different feeding specializations within the genus. They concluded that feeding on errant (i.e., non-sedentary) polychaete annelid worms was probably the ancestral character state for this group. Mollusc-eating appears to have arisen only once in this group. Fish-eating may have arisen several times, but the phylogeny was not sufficiently well resolved to draw any strong conclusion on this question. Type of prey consumed appears to be a relatively conservative trait, with diets having shifted only rarely since the first major Conus radiation in the Miocene (Duda et al. 2001).

Conus provides one of the few known examples of a marine "species flock" (Duda and Rolan 2005). (A species flock is a monophyletic assemblage of endemic taxa (i.e., taxa found nowhere else) that arose rapidly in a small geographical area--classic examples being Darwin's finches in the Galapagos and African rift lake cichlid fish in East Africa). The Cape Verde Archipelago has 47 endemic and just three non-endemic Conus species. Based on a molecular phylogenetic analysis, Duda and Rolan conclude that the contemporary endemic Conus species in the Cape Verde islands are the evolutionary descendants of two separate colonization events. The authors suggest that the life history of the Cape Verde Conus may have facilitated their isolation through evolutionary time: Although, overall, ~75% of Conus species whose mode of development is known have an obligate planktonic, feeding larval stage in their life history, this is not the case for eastern Atlantic species (including all the Cape Verde Conus), nearly all of which are direct devopers, meaning they have no dispersing larval phase (Duda and Rolan 2005 and references therein).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional Adaptations

Functional adaptation

Poisonous tooth shoots into prey: cone snail
 

The teeth of cone nails are used to attack prey, detaching and shooting like a harpoon, releasing nerve poison into their victim.

       
  "Cone snails use an extensile, tubular proboscis as a conduit to  deliver a potent cocktail of bioactive venom peptides into their  prey. Previous studies have focused mainly on understanding the  venom's role in prey capture but successful prey capture requires  both rapid physiological and biomechanical mechanisms. Conus  catus, a fish-hunting species, uses a high-speed hydraulic mechanism  to inject its hollow, spear-like radular tooth into prey. We  take an integrated approach to investigating the biomechanics of  this process by coupling kinematic studies with morphological analyses.  Taking advantage of the opaque venom and translucent proboscis  of a mollusc-hunting juvenile cone snail, Conus pennaceus, we  have determined that a high-speed prey capture mechanism is  not unique to cone species that hunt fish prey. Two morphological structures  were found to play crucial roles in this process. A  constriction of the lumen near the tip of the proboscis, composed of  tall epithelial cells densely packed with microfilaments, impedes  forward movement of the radular tooth prior to its propulsion. Proximal  to the constriction, a muscular sphincter was found to  regulate venom flow and pressurization in the proboscis. In C.  pennaceus, the rapid appearance and flushing of venom within  the proboscis during prey capture suggests a mechanism involving  the delivery of a discrete quantity of venom. The interplay  between these elements provides a unique and effective biomechanical  injection system for the fast-acting cone snail venom  peptides." (Salisbury et al. 2010:673)

Watch a 3D animation

  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
  • Salisbury SM; Martin GG; Kier WM; Schulz JR. 2010. Venom kinematics during prey capture in Conus: the biomechanics of a rapid injection system. Journal of Experimental Biology. 213: 673-682.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physiology and Cell Biology

Physiology

Each of the roughly 500 Conus species produces 100-200 venom peptides, with little overlap between species (Olivera 2002). Conus venom research has been reviewed by Olivera (2002), among others.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Conus aff. Rattus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Conus aff. Rattus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Conus cf. joliveti

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACACTTTATATTTTATTTGGGATGTGATCTGGTTTGGTTGGTACTGCTTTAAGTCTCTTGATTCGTGCTGAGTTAGGTCAACCTGGAGCTTTGTTAGGCGATGATCAGTTATACAATGTAATCGTAACTGCTCATGCTTTTGTAATGATTTTTTTTCTTGTAATACCGATGATAATTGGTGGTTTTGGTAATTGATTAGTTCCTTTAATGTTAGGAGCTCCTGATATGGTTTTTCCTCGATTAAATAATATAAGATTTTGACTTTTACCTCCTGCATTACTTCTACTCCTATCTTCAGCTGCAGTTGAGGGTGGTGTTGGAACTGGATGAACTGTATATCCTCCATTGGCAGGAAATTTAGCTCATGCTGGAGGTTCGGTAGATTTGGCTATTTTTTCTCTTCATCTTGCAGGGGTTTCTTCTATTTTAGGAGCTGCAAATTTTATTAGAACTATTATTAATATACGATGACAGGCAGTAAAATTTGAACGACTATCACTTTTTGTATGATCAGTAAAGATTACAGCAATTTTATTACTTTTATCTCTACCTGTATTAGCTGGTGCAATTACTATATTACTAACGGATCGAAATTTCAATACCACATTTTTTGATCCAGCAGGAGGTGGAGATCCTGTATTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Conus cf. joliveti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:1,079Public Records:714
Specimens with Sequences:1,006Public Species:101
Specimens with Barcodes:790Public BINs:93
Species:129         
Species With Barcodes:108         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Conus

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 2 specimens with morphological vouchers housed at Museum of Tropical Queensland and Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Risk Statement

Stings from several Conus species have been reported to cause human fatalities, although only fatalities from C. geographus have been confirmed; it is estimated that a quarter of stings from C. geographus may be fatal to humans, but such encounters are fortunately rare (Fegan and Andresen 1997). About 3 dozen recorded human fatalities from C. geographus stings have been recorded in the medical literature (Olivera 2002). Symptoms from a cone snail sting vary somewhat depending on the species. There may be extreme pain, or a spreading numbness followed by paralysis (McIntosh and Jones 2001). In general, the venoms of fish-hunting species are more lethal to vertebrates (Kohn et al. 1960, cited in Olivera 2002).

Several toxic peptides from Conus species are widely used as research tools and active efforts are underway to screen Conus toxins for potential development as useful drugs. Among the possible conditions being considered as potential targets for these new drugs are chronic pain, epilepsy, cardiovascular disease, psychiatric disorders, movement disorders, cancer, and stroke (McIntosh and Jones 2001). Conus-derived products might also be useful as neuromuscular blocking agents in anesthesia. The appeal to researchers of the rich diversity of cone snail toxins is the novelty and/or specificity with which they target a given receptor or ion channel (McIntosh and Jones 2001).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Conus kuroharai

Conus kuroharai is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Distribution

References

  1. ^ a b Conus kuroharai (Habe, 1965).  Retrieved through: World Register of Marine Species on 27 March 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus ermineus

Conus ermineus is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Distribution

Description

The maximum recorded shell length is 103 mm.[2]

Conantokin-E is a toxin derived from the venom of Conus ermineus.

Habitat

Minimum recorded depth is 0 m.[2] Maximum recorded depth is 101 m.[2]

References

  1. ^ a b Conus ermineus Born, 1778.  Retrieved through: World Register of Marine Species on 27 March 2010.
  2. ^ a b c Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.

Gallery

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus diadema

Conus diadema is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Distribution

References

  1. ^ a b Conus diadema G. B. Sowerby II, 1834.  Retrieved through: World Register of Marine Species on 27 March 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus delessertii

Conus delessertii is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Distribution

Description

The maximum recorded shell length is 100 mm.[2]

Habitat

Minimum recorded depth is 15 m.[2] Maximum recorded depth is 198 m.[2]

References

  1. ^ a b Conus delessertii Récluz, 1843.  Retrieved through: World Register of Marine Species on 27 March 2010.
  2. ^ a b c Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus chiangi

Conus chiangi is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Distribution

References

  1. ^ a b Conus chiangi (Azuma, 1972).  Retrieved through: World Register of Marine Species on 27 March 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus cancellatus

Conus cancellatus, common name the cancellate cone, is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Distribution

this species occurs in the Caribbean Sea, the Gulf of Mexico and the Lesser Antilles.

Description

The maximum recorded shell length is 80 mm.[2]

The pear-shaped shell is broad and angulated at the shoulder, contracted towards the base. The body whorl is closely sulcate throughout, the sulci striate. The intervening ridges are rounded. The spire carinate and concavely elevated. Its apex is acute and striate. The color of the shell is whitish, obscurely doubly banded with clouds of light chestnut. The spire is maculated with the same. [3]

Habitat

Minimum recorded depth is 26 m.[2] Maximum recorded depth is 110 m.[2]

References

  1. ^ a b Conus cancellatus Hwass in Bruguière, 1792.  Retrieved through: World Register of Marine Species on 27 March 2010.
  2. ^ a b c Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
  3. ^ George Washington Tryon, Manual of Conchology, vol. VI, p. 74-75; 1879
  • Filmer R.M. (2001). A Catalogue of Nomenclature and Taxonomy in the Living Conidae 1758 - 1998. Backhuys Publishers, Leiden. 388pp.
  • Rosenberg, G., F. Moretzsohn, and E. F. García. 2009. Gastropoda (Mollusca) of the Gulf of Mexico, Pp. 579–699 in Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College Station, Texas
  • Tucker J.K. (2009). Recent cone species database. September 4th 2009 Edition
  • Tucker J.K. & Tenorio M.J. (2009) Systematic classification of Recent and fossil conoidean gastropods. Hackenheim: Conchbooks. 296 pp.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus arcuatus

Conus arcuatus is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Distribution

Golfo de California, Mexico to Peru. Type locality near Mazatlán, Sinaloa, Mexico.[2]

References

  1. ^ Conus arcuatus Broderip & G. B. Sowerby I, 1829.  Retrieved through: World Register of Marine Species on 27 March 2010.
  2. ^ Tenorio M.J., Tucker J.K. & Chaney H.W. (2012). The Families Conilithidae and Conidae. The Cones of the Eastern Pacific. In: Poppe G.T. & Groh K. (eds): A Conchological Iconography. Hackenheim: ConchBooks. 112 pp., 88 pls.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus cordigera

Conus cordigera is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Distribution

References

  1. ^ Conus cordigera G. B. Sowerby II, 1866.  Retrieved through: World Register of Marine Species on 27 March 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus zapatosensis

Conus zapatosensis is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1][2]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Distribution

Conus zapatosensis is restricted to the central and southern Philippines with a dubiously reported specimen from Singapore. The type locality is situated near Zapatos Island, Negros, the Philippines. Paratypes are from Marinduque and Burias Straight.[2]

References

  1. ^ Conus zapatosensis Röckel, 1987.  Retrieved through: World Register of Marine Species on 27 March 2010.
  2. ^ a b R. M. Filmer (2011). "Taxonomic revision of the Conus spectrum, Conus stramineus and Conus collisus complexes (Gastropoda – Conidae). Part II: The Conus stramineus complex". Visaya 3 (4): 4–66.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus radiatus

Conus radiatus is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Conantokin-C is a toxin derived from the venom of Conus radiatus.

Distribution

References

  1. ^ a b Conus radiatus Gmelin, 1791.  Retrieved through: World Register of Marine Species on 27 March 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus oishii

Conus oishii is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Distribution

References

  1. ^ a b Conus oishii (Shikama, 1977).  Retrieved through: World Register of Marine Species on 27 March 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus limpusi

Conus limpusi is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Distribution

This is an Australia Queensland species.


References

  1. ^ a b Conus limpusi Röckel & Korn, 1990.  Retrieved through: World Register of Marine Species on 27 March 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus joliveti

Conus joliveti is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Distribution

References

  1. ^ Conus joliveti Moolenbeek, Röckel & Bouchet, 2008.  Retrieved through: World Register of Marine Species on 27 March 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus janus

Conus janus is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Distribution

References

  1. ^ a b Conus janus Hwass in Bruguière, 1792.  Retrieved through: World Register of Marine Species on 27 March 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus eucoronatus

Conus eucoronatus is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Distribution

References

  1. ^ Conus eucoronatus G. B. Sowerby III, 1903.  Retrieved through: World Register of Marine Species on 27 March 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus episcopatus

Conus episcopatus is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Distribution

References

  1. ^ Conus episcopatus Da Motta, 1982.  Retrieved through: World Register of Marine Species on 27 March 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus distans

Conus distans is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Distribution

References

  1. ^ a b Conus distans Hwass in Bruguière, 1792.  Retrieved through: World Register of Marine Species on 27 March 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus dayriti

Conus dayriti is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Distribution

References

  1. ^ Conus dayriti Röckel & da Motta, 1983.  Retrieved through: World Register of Marine Species on 27 March 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus cuvieri

Conus cuvieri is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Distribution

References

  1. ^ a b Conus cuvieri Crosse, 1858.  Retrieved through: World Register of Marine Species on 27 March 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus corallinus

Conus corallinus is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Distribution

References

  1. ^ Conus corallinus Kiener, 1845.  Retrieved through: World Register of Marine Species on 27 March 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus chaldaeus

Conus chaldaeus is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Distribution

References

  1. ^ a b Conus chaldaeus (Röding, 1798).  Retrieved through: World Register of Marine Species on 27 March 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus centurio

Conus centurio is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Distribution

A Western Atlantic species
known from the continental shelf of Guyana and Northern South America
and from Monos Isl. Trinidad, St.Vincent and Barbados, in the Lesser Antilles

Description

The maximum recorded shell length is 85.5 mm.[2]

Habitat

Minimum recorded depth is 2 m.[2] Maximum recorded depth is 175 m.[2]

References

  1. ^ a b Conus centurio Born, 1778.  Retrieved through: World Register of Marine Species on 27 March 2010.
  2. ^ a b c Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus berdulinus

Conus berdulinus is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Distribution

References

  1. ^ Conus berdulinus Veillard, 1972.  Retrieved through: World Register of Marine Species on 27 March 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus belairensis

Conus belairensis is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Distribution

References

  1. ^ Conus belairensis Pin & Leung Tack in Pin, 1989.  Retrieved through: World Register of Marine Species on 27 March 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus bayeri

Conus bayeri is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Distribution

Description

The maximum recorded shell length is 16 mm.[2]

Habitat

Minimum recorded depth is 35 m.[2] Maximum recorded depth is 35 m.[2]

References

  1. ^ Conus bayeri Petuch, 1987.  Retrieved through: World Register of Marine Species on 27 March 2010.
  2. ^ a b c Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus axelrodi

Conus axelrodi is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Distribution

References

  1. ^ Conus axelrodi Walls, 1978.  Retrieved through: World Register of Marine Species on 27 March 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus aurisiacus

Conus aurisiacus is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Distribution

References

  1. ^ Conus aurisiacus Linnaeus, 1758.  Retrieved through: World Register of Marine Species on 27 March 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus aureus

Conus aureus is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.


Contents

Description

Distribution

References

  1. ^ a b c Conus aureus Hwass in Bruguière, 1792.  Retrieved through: World Register of Marine Species on 27 March 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus arenatus

Conus arenatus, common name the sand-dusted cone, is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

These snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Distribution

This is an Indo-Pacific species.

References

  1. ^ a b Conus arenatus Hwass in Bruguière, 1792.  Retrieved through: World Register of Marine Species on 27 March 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus anabelae

Conus anabelae is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Distribution

References

  1. ^ Conus anabelae Rolán & Röckel, 2001.  Retrieved through: World Register of Marine Species on 20 March 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus amadis

Conus amadis, common name: the Amadis cone, is a species of predatory sea snail, a marine gastropod mollusk in the family Conidae, the cone snails or cones.[1]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

The size of an adult shell varies between 40 mm and 110 mm. The spire is striate, channeled, concavely elevated, sharp-pointed. It has a sharp shoulder angle. The lower part of body whorl is punctured and grooved The color of the shell is orange-brown to chocolate, thickly covered with large and small subtriangular white spots, which by their varied disposition sometimes form a white central band, or dark bands above and below the center, the latter occasionally bearing articulated revolving lines.[2]

Distribution

This marine species occurs in the Mascarene Basin, in the Indian Ocean and in the Pacific Ocean along Indonesia, New Caledonia and Polynesia.

References

  1. ^ a b Conus amadis Gmelin, 1791.  Retrieved through: World Register of Marine Species on 12 July 2011.
  2. ^ George Washington Tryon, Manual of Conchology vol. VI, p. 30; 1884
  • Drivas, J. & M. Jay (1988). Coquillages de La Réunion et de l'île Maurice
  • Filmer R.M. (2001). A Catalogue of Nomenclature and Taxonomy in the Living Conidae 1758 - 1998. Backhuys Publishers, Leiden. 388pp
  • Tucker J.K. (2009). Recent cone species database. September 4, 2009 Edition
  • Tucker J.K. & Tenorio M.J. (2009) Systematic classification of Recent and fossil conoidean gastropods. Hackenheim: Conchbooks. 296 pp
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus

"Cucullus" redirects here. This may also refer to part of the clasper in male insect genitalia.

Conus is a large genus of small to large predatory sea snails, marine gastropod molluscs, with the common names of cone snails, cone shells or cones. This genus is placed in the subfamily Coninae within the family Conidae. Geologically speaking, the genus is known from the Eocene to the Recent (Holocene) periods.[3] Conus species have shells that are shaped more or less like geometric cones. Many species have colorful patterning on the shell surface. Conus snails are mostly tropical in distribution.

Because all Conus snails are venomous and capable of "stinging" humans, live ones should be handled with great care or preferably not at all. The species most dangerous to humans are the larger ones which prey on small bottom-dwelling fish. The other species hunt and eat marine worms or mollusks. Cone snails use a hypodermic-like modified radula tooth and a venom gland to attack and paralyze their prey before engulfing it. The tooth is sometimes likened to a dart or a harpoon. It is barbed and can be extended some distance out from the mouth of the snail, at the end of the proboscis.

Cone snail venoms are mainly peptides. The venoms contain many different toxins that vary in their effects; some are extremely toxic. The sting of small cones is no worse than a bee sting, but the sting of a few of the larger species of tropical cone snails can be serious, occasionally even fatal to human beings. In recent years cone snail venom is showing great promise as a source of new, medically important substances.[4][5]

Contents

Distribution and habitat

There are over 600 different species of cone snails.[2] This family is typically found in warm and tropical seas and oceans worldwide, and reaches its greatest diversity in the Western Indo-Pacific Region. However, some species of Conus are adapted to temperate environments, such as the Cape coast of South Africa,[6][7] the Mediterranean,[8] or the cool waters of southern California (Conus californicus),[9] and are endemic to these areas.

This genus is found in all tropical and subtropical seas from tidal waters to deeper areas, living on sand or among rocks or coral reefs. When living on sand, these snails will bury themselves with only the siphon protruding from the surface. Many tropical cone snails live in or near coral reefs. Some species are found under rocks in the lower intertidal and shallow subtidal zones.

Shell description

This genus shows a large variety of colors and patterns, and local varieties and color forms of the same species often occur. This has led to the creation of a large number of known synonyms and probable synonyms, making it difficult to give an exact taxonomic assignment for many snails in this genus. As of 2009, more than 3,200 different species names have been assigned to snails in the genus Conus, with an average of 16 new species names introduced a year.[10]

The shells of Conus species vary in size. The shells are shaped more or less like the geometric shape known as a cone, as one might expect from the popular and scientific name. The shell is many-whorled and in the form of an inverted cone, the anterior end being the narrow end. The protruding parts of the top of the whorls that form the spire are more or less in the shape of another, much more flattened, cone. The aperture is elongated and narrow. The horny operculum is very small. The outer lip is simple, thin and sharp and without a callus. The outer lip has a notched tip at the upper part. The columella is straight.

The larger species of cone snails can grow up to 23 cm in length. The shells of cone snails are often brightly colored, and have interesting patterns, although in some species the color patterns may be partially or completely hidden under an opaque layer of periostracum. In other species the topmost shell layer is thin periostracum, a transparent yellowish or brownish membrane.

Life habits

Cone snails are carnivorous, and predatory. They hunt and eat prey such as marine worms, small fish, mollusks, and even other cone snails. Because cone snails are slow-moving, they use a venomous harpoon (called a toxoglossan radula) to capture faster-moving prey such as fish. The venom of a few larger species, especially the piscivorous ones, is powerful enough to kill a human being.

The osphradium (a chemoreceptory organ) in the family Conidae is more highly specialized than the same organ in any other family of gastropods. It is through this sensory modality that cone snails become aware of the presence of a prey animal, not through vision. The cone snails immobilize their prey using a modified, dartlike, barbed radular tooth, made of chitin, along with a poison gland containing neurotoxins. Small species of these cone snails hunt small prey such as marine worms, whereas larger cone snails hunt live fish.

Molecular phylogeny research by Kraus et al. (2010)[11] based on a part of "intron 9" of the gamma-glutamyl carboxylase gene has shown that feeding on fish in Conus has evolved at least twice independently.

Harpoon and venoms

An individual Conus pennaceus attacking one of a cluster of three snails of the species Cymatium nicobaricum, in Hawaii

Cone snails use a radula tooth as a harpoon-like structure for predation. Each of these harpoons is a modified tooth, primarily made of chitin and formed inside the mouth of the snail, in a structure known as the radula. (The radula in most gastropods has rows of many small teeth, and is used for grasping at food and scraping it into the mouth.) Each specialized cone snail tooth is stored in the radula sac (an evaginated pocket in the posterior wall of the buccal cavity), except the tooth that is currently ready to be used.

The tooth is hollow and barbed, and is attached to the tip of the radula in the radular sac, inside the snail's throat. When the snail detects a prey animal nearby, it extends a long flexible tube called a proboscis towards the prey. The radula tooth is loaded with venom from the poison bulb and, still attached to the radula, is fired from the proboscis into the prey by a powerful muscular contraction. The venom paralyzes small fish almost instantly. The snail then retracts the radula, drawing the subdued prey into the mouth. After the prey has been digested, the cone snail will regurgitate any indigestible material such as spines and scales, along with the then-disposable harpoon. There is always a dart stored in the radular sac. A dart may be used in self-defense when the snail feels threatened.

The tropical cone snail Conus purpurascens uses its special modified radular teeth to fire a retrievable hollow dart at small fish and inject a toxin. The toxin rapidly paralyses the fish, which the cone snail then swallows.[12][13]

All cone snail species are equipped with a battery of toxic harpoons which can fire in any direction, even backwards. Some of these toxins can be fatal to humans.[14]

The venom of cone snails contains hundreds of different compounds, and its exact composition varies widely from one species of cone snail to another. The toxins in these various venoms are called conotoxins. These are various peptides, each targeting a specific nerve channel or receptor. Some cone snail venoms also contain a pain-reducing toxin, which the snail uses to pacify the victim before immobilising and then killing it.

Relevance to humans

Risks

A live Textile cone, Conus textile, one of the dangerous cones to handle.

[citation needed]

The bright colors and patterns of cone snails are attractive to the eye, and therefore people sometimes pick up the live animals and hold them in their hand for a while. This is risky, because the snail often fires its harpoon in these situations. In the case of the larger species of cone snail, the harpoon is sometimes capable of penetrating the skin, even through gloves or wetsuits.

The sting of many of the smallest cone species may be no worse than that of a bee or hornet sting,[15] but in the case of a few of the larger tropical fish-eating species, especially Conus geographus, Conus tulipa and Conus striatus, a sting can sometimes have fatal consequences. Other dangerous species are Conus pennaceus, Conus textile, Conus aulicus, Conus magus and Conus marmoreus.[16] According to Goldfrank's Toxicologic Emergencies, only about 15 human deaths can be confidently attributed to cone snail envenomation.

Most of the cone snails that hunt worms rather than fish are probably not a real risk to humans, with the possible exception of larger species such as Conus vexillum or Conus quercinus.[citation needed] One of the fish-eating species, the geography cone, Conus geographus, is also known colloquially as the "cigarette snail," a gallows humor exaggeration implying that, when stung by this creature, the victim will have only enough time to smoke a cigarette before dying.[17][18]

Symptoms of a more serious cone snail sting include intense, localized pain, swelling, numbness and tingling and vomiting. Symptoms can start immediately or can be delayed in onset for days. Severe cases involve muscle paralysis, changes in vision and respiratory failure that can lead to death. There is no antivenom, and treatment involves providing life support until the venom is metabolised by the victim.[citation needed]

Medical use of the venom

The appeal of the cone snail's venom for creating pharmaceutical drugs is the precision and speed with which the various components act; many of the compounds target a particular class of receptor, to the exclusion of any other. This means that in isolation, they can reliably and quickly produce a particular effect on the body's systems without side effects; for example, almost instantly reducing heart rate or turning off the signaling of a single class of nerve, such as pain receptors.

The venom of some cone snails, such as the magician cone, Conus magus, shows much promise for providing a non-addictive pain reliever 1000 times as powerful as, and possibly a replacement for, morphine.[19]

Many peptides produced by the cone snails show prospects for being potent pharmaceuticals, such as AVC1, isolated from the Australian species, the Queen Victoria cone, Conus victoriae. This has proved very effective in treating postsurgical and neuropathic pain, even accelerating recovery from nerve injury.

The first painkiller derived from cone snail toxins, ziconotide, was approved by the U.S. Food and Drug Administration in December 2004 under the name "Prialt". Other drugs are in clinical and preclinical trials, such as compounds of the toxin that may be used in the treatment of Alzheimer's disease, Parkinson's disease, depression, and epilepsy.[20] [21]

Shell collecting

The intricate color patterns of cones have made them one of the most popular collectible shells.[22][23]

Conus gloriamaris, the "Glory of the Seas" cone was, in earlier centuries, one of the most famous and sought-after seashells, with only a few specimens in private collections. This apparent rarity meant that shells of this species fetched very high prices, until finally the habitat for this cone was discovered. Sizable populations were then located, and this brought the price down dramatically.[24]

As jewelry

Naturally-occurring, beachworn cone shell "tops" (the broken-off spire of the shell, which usually end up with a hole worn at the tip) can function as beads without any further modification. In Hawaii, these natural beads were traditionally collected from the beach drift to make puka shell jewelry. Since it is hard to obtain enough naturally-occurring cone tops, almost all modern puka shell jewelry uses cheaper imitations, cut from thin shells of other species of mollusk, or even made of plastic.

Species

Shell of Conus aulicus

The number of valid names of recent species in the genus Conus is over 600[2] and there are, in addition, a large number of fossil species.

Prior to 2009, all species within the family Conidae were still placed in one genus Conus. Testing in order to try to understand the molecular phylogeny of the Conidae was initially begun by Christopher Meyer and Alan Kohn,[25] and is continuing, particularly with the advent of nuclear DNA testing in addition to mDNA testing.

In 2009, J.K. Tucker and M.J. Tenorio proposed a classification system consisting of 3 distinct families and 82 genera for the living species of cone snails. This classification was based upon shell morphology, radular differences, anatomy, physiology, cladistics, with comparisons to molecular (DNA) studies.[26] Published accounts of genera within the Conidae that use these new genera include J.K. Tucker & M.J. Tenorio (2009), and Bouchet et al. (2011).[27] Tucker and Tenorio's proposed classification system for the cone shells and their allies (and the other clades of Conoidean gastropods ) is shown in Tucker & Tenorio cone snail taxonomy 2009.

Some experts however currently (2011) prefer to keep using the traditional classification, where all species are placed in Conus within the single family Conidae: for example, according to the current November 2011 version of the World Register of Marine Species, all species within the family Conidae are in the genus Conus. The binomial names of species in the 82 genera of living cone snails listed in Tucker & Tenorio 2009 are recognized by the World Register of Marine Species as "alternative representations." [28] Debate within the scientific community regarding this issue continues, and additional molecular phylogeny studies are being carried out in an attempt to clarify the issue.[26][29][30][31][32][33][34][35][36][37]

See also

  • ConoServer, a database of cone snail toxins, known as conopeptides.[38] These toxins are of importance to medical research.

References

  1. ^ Linnaeus C. (1758). Systema Naturae, ed. 10, 712; 1767, ed. 12, 1165.
  2. ^ a b c Conus Linnaeus, 1758.  Retrieved through: World Register of Marine Species on 20 May 2010.
  3. ^ (Czech) Pek I., Vašíček Z., Roček Z., Hajn. V. & Mikuláš R. (1996). Základy zoopaleontologie. Olomouc, 264 pp., ISBN 80-7067-599-3.
  4. ^ Olivera BM, Teichert RW (2007). "Diversity of the neurotoxic Conus peptides: a model for concerted pharmacological discovery". Molecular Interventions 7 (5): 251–60. doi:10.1124/mi.7.5.7. PMID 17932414. http://triggered.edina.clockss.org/ServeContent?url=http%3A%2F%2Fmolinterv.aspetjournals.org%2Fcontent%2F7%2F5%2F251.full.
  5. ^ Roger Van Oosten (September 2008). "Nature's brew". Quest online. http://www.fhcrc.org/about/pubs/quest/articles/2008/09/natures_brew.html.
  6. ^ Tenorio, M. J. & Monteiro, A. J. (2008). The Family Conidae. The South African species of Conus. In: Poppe, G. T. & Groh, K. (eds): A Conchological Iconography. Hackenheim: ConchBooks. 47 pp., 60 pls.
  7. ^ Branch, G.M. Griffiths, C.L. Branch, M.L. Beckley, L.E. (2010). Two oceans : a guide to the marine life of Southern Africa. Cape Town: Struik Nature. ISBN 978-1-77007-772-0.
  8. ^ Monteiro, A. J., Tenorio, M. J. & Poppe, G. T. (2004). The Family Conidae. The West African and Mediterranean species of Conus. In: Poppe, G. T. & Groh, K. (eds): A Conchological Iconography. Hackenheim: ConchBooks. 102 pp., 164 pls.
  9. ^ Tenorio, M. J., Tucker, J. K. & Chaney, H. W. (2012). The Families Conilithidae and Conidae. The Cones of the Eastern Pacific. In: Poppe, G. T. & Groh, K. (eds): A Conchological Iconography. Hackenheim: ConchBooks. 112 pp., 88 pls.
  10. ^ The Conus biodiversity website
  11. ^ Kraus N. J., Corneli P. S., Watkins M., Bandyopadhyay P. K., Seger J. & Olivera B. M. (in press, available online 13 December 2010). "Against Expectation: A Short Sequence With High Signal Elucidates Cone Snail Phylogeny". Molecular Phylogenetics and Evolution doi:10.1016/j.ympev.2010.11.020.
  12. ^ National Geographic Cone Snail Profile
  13. ^ Kohn, Alan J. (March 1956). "PISCIVOROUS GASTROPODS OF THE GENUS CONUS". Proc Natl Acad Sci U S A 42 (3): 168–171. doi:10.1073/pnas.42.3.168. PMC 528241. PMID 16589843. //www.ncbi.nlm.nih.gov/pmc/articles/PMC528241/.
  14. ^ Dart, RC and Caravati, EM (2004) Medical Toxicology Lippincott Williams. ISBN 978-0-7817-2845-4
  15. ^ Marine wounds and stings
  16. ^ Killer Cones
  17. ^ NIGMS - Findings, September 2002: Secrets of the Killer Snails
  18. ^ Geographic Cone Snail, Geographic Cone Snail Profile, Facts, Information, Photos, Pictures, Sounds, Habitats, Reports, News - National Geographic
  19. ^ ANI (2007). "Sea snail venom paves way for potent new painkiller". Compassionate health care network. http://www.chninternational.com/cone_snail_venom_attacking_pain.htm. Retrieved 2008-11-19.
  20. ^ Louise Yeoman (2006-03-28). "Venomous snails aid medical science". BBC. http://news.bbc.co.uk/2/hi/science/nature/4846504.stm. Retrieved 2008-11-19.
  21. ^ http://www.scientificamerican.com/article.cfm?id=healing-the-brain-with-snail-venom
  22. ^ Conidae - worldwideconchology
  23. ^ Conus gloriamaris
  24. ^ Conus gloriamaris, Glory of the Seas Cone photos, Phillip Colla Natural History Photography :: Online Photo Search
  25. ^ Interview of Professor Alan Kohn, Professor Emeritus, Zoologyhttp://www.seashell-collector.com/articles/interviews/2009-kohn.html
  26. ^ a b Tucker J.K. & Tenorio M.J. (2009), Systematic Classification of Recent and Fossil Conoidean Gastropods, ConchBooks, Hankenheim, Germany, 295 pp.
  27. ^ Bouchet P., Kantor Yu.I., Sysoev A. & Puillandre N. (2011). "A new operational classification of the Conoidea". Journal of Molluscan Studies 77: 273-308.
  28. ^ http://www.marinespecies.org/aphia.php?p=taxdetails&id=14107 Classification: Traditionally, all cone shells have been included in the Linnaean genus Conus. Tucker & Tenorio (2009) have recently proposed an alternative shell- and radula-based classification that recognizes 4 families and 80 genera of cones. In WoRMS, we currently still recognize a single family Conidae (following Puillandre et al. 2011), but Tucker & Tenorio's 80 genera classification is presented as "alternative representation". [P. Bouchet, 14 Aug. 2011]
  29. ^ C.M.L. Afonso & M.J. Tenorio (August 2011), A new, distinct endemic Africonus species (Gastropoda, Conidae) from Sao Vicente Island, Cape Verde Archipelago, West Africa, Gloria Maris 50(5): 124-135
  30. ^ P. Bouchet, Yu I. Kantor, A. Sysoev, and N. Puillandre (March 2011), A New Operational Classification of the Conoidea, Journal of Molluscan Studies 77:273-308, at p. 275.
  31. ^ N. Puillandre, E. Strong, P. Bouchet, M. Boisselier, V. Couloux, & S. Samadi (2009), Identifying gastropod spawn from DNA barcodes: possible but not yet practicable, Molecular Ecology Resources 9:1311-1321.
  32. ^ P.K. Bandyopadhyay, B.J. Stevenson, J.P. Ownby, M.T. Cady, M. Watkins, & B. Olivera (2008), The mitochondrial genome of Conus textile, coxI-conII intergenic sequences and conoidean evolution. Mollecular Phylogenetics and Evolution 46: 215-223.
  33. ^ S.T. Williams & T.F. Duda, Jr. (2008), Did tectonic activity stimulate Oligo-Miocene speciation in the Indo-West Pacific? Evolution 62:1618-1634.
  34. ^ R.L. Cunha, R. Castilho, L. Ruber, & R. Zardoya (2005), Patterns of cladogenesis in the venomous marine gastropod genus Conus from the Cape Verde Islands Systematic Biology 54(4):634-650.
  35. ^ T.F. Duda, Jr. & A.J. Kohn (2005), Species-level phylogeography and evolutionary history of the hyperdiverse marine gastropod genus Conus, Molecular Phylogenetics and Evolution 34:257-272.
  36. ^ T.F. Duda, Jr. & E. Rolan (2005), Explosive radiation of Cape Verde Conus, a marine species flock, Molecular Ecology 14:267-272.
  37. ^ B. Vallejo, Jr. (2005), Inferring the mode of speciation in the Indo-West Pacific Conus (Gastropoda: Conidae), Journal of Biogeography 32:1429-1439.
  38. ^ Kaas, Quentin; Yu Rilei, Jin Ai-Hua, Dutertre Sébastien, Craik David J (Jan 2012). "ConoServer: updated content, knowledge, and discovery tools in the conopeptide database" (in eng). Nucleic Acids Res. (England) 40 (Database issue): D325-30. doi:10.1093/nar/gkr886. PMC 3245185. PMID 22058133. //www.ncbi.nlm.nih.gov/pmc/articles/PMC3245185/.

Further reading

  • Goldfrank's Toxicologic Emergencies, 8th Edition, Edited by Neal E Flomenbaum, Lewis R Goldfrank, Robert S Hoffman, Mary Ann Howland, Neal A Lewin, and Lewis S Nelson. Published by McGraw-Hill, New York, ISBN 978-0-07-143763-9
  • Gmelin, J. F. 1791. Systema naturae per regna tria naturae. Editio decima tertia. Systema Naturae, 13th ed., vol. 1(6): 3021-3910. Lipsiae.
  • Bruguière, [J.-G.] 1792. Encyclopédie Méthodique. Histoire Naturelle des Vers. Encyclopédie Méthodique. Histoire Naturelle des Vers 1: 345-757. Panckoucke: Paris.
  • Sowerby, G. B., II. 1833. Conus. Conchological Illustrations pls. 36-37
  • (French) Bernardi A. C. (1858). Monographie du genre Conus.
  • Reeve, L. 1844. Monograph of the genus Conus. Conchologia Iconica 1: pls. 40-47
  • Kiener, L. C. 1845. Genre Cone. (Conus, Lin.). Spécies Général et Iconographie des Coquilles Vivantes 2: pls. 1-111
  • Clench, W. J. 1942. The Genus Conus in the Western Atlantic. Johnsonia 1(6): 1-40
  • Van Mol, J. J., B. Tursch and M. Kempf. 1967. Mollusques prosobranches: Les Conidae du Brésil. Étude basée en partie sur les spécimens recueillis par la Calypso. Annales de l'Institut Océanographique 45: 233-254, pls. 5-10
  • Vink, D. L. N. and R. von Cosel. 1985. The Conus cedonulli complex: Historical review, taxonomy and biological observations. Revue Suisse de Zoologie 92: 525-603
  • Petuch, E. J. 1986. New South American gastropods in the genera Conus (Conidae) and Latirus (Fasciolariidae). Proceedings of the Biological Society of Washington 99: 8-14.
  • Petuch, E. J. 1987. New Caribbean molluscan faunas. [v] + 154 + A1-A4, 29 pls. Coastal Education & Research Foundation: Charlottesville, Virginia
  • Petuch, E. J. 1988. Neogene history of tropical American mollusks. [vi] + 217, 39 pls. Coastal Education & Research Foundation: Charlottesville, Virginia
  • Petuch, E. J. 1990. A new molluscan faunule from the Caribbean coast of Panama. Nautilus 104: 57-70
  • Petuch, E. J. 1992. Molluscan discoveries from the tropical Western Atlantic region. Part II. New species of Conus from the Bahamas Platform, Central American and northern South American coasts, and the Lesser Antilles. La Conchiglia 24(265): 10-15.
  • Petuch, E. J. 2000. A review of the conid subgenus Purpuriconus da Motta, 1991, with the descriptions of two new Bahamian species. Ruthenica 10: 81-87
  • Petuch, E. J. 2004. Cenozoic Seas. xvi + 308 pp. CRC Press: Boca Raton
  • Tenorio, M. J., Tucker, J. K. & Chaney, H. W. (2012). The Families Conilithidae and Conidae. The Cones of the Eastern Pacific. In: Poppe G.T. & Groh K. (eds): A Conchological Iconography. Hackenheim: ConchBooks. 112 pp., 88 pls.
  • Coltro, J., Jr. 2004. New species of Conidae from northeastern Brazil (Mollusca: Gastropoda). Strombus 11: 1-16
  • García, E. F. 2006. Conus sauros, a new Conus species (Gastropoda: Conidae) from the Gulf of Mexico. Novapex 7: 71-76
  • Franklin JB, Subramanian KA, Fernando SA, & Krishnan KS 2009. Diversity and Distribution of Conidae from the Tamil Nadu Coast of India (Mollusca: Caenogastropoda: Conidae). Zootaxa 2250: 63 pp.
  • J. Benjamin Franklin, S. Antony Fernando, B. A. Chalke, K. S. Krishnan 2007. Radular morphology of Conus (Gastropoda: Caenogastropoda: Conidae) from India. Molluscan Research 27(3): 111–122. ISSN 1323-5818
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus compressus


Conus compressus is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[1][2]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

References

  1. ^ a b Bouchet, P. (2011). Conus compressus G. B. Sowerby II, 1866. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=429368 on 2012-01-21
  2. ^ Filmer R.M. (2001). A Catalogue of Nomenclature and Taxonomy in the Living Conidae 1758 - 1998. Backhuys Publishers, Leiden. 388pp.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Conus advertex

Conus advertex is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails, cone shells or cones.[1][2]

These snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Distribution

This species of cone snail is endemic to Australia.[2]

References

  1. ^ a b Bouchet, P. (2011). Conus advertex (Garrard, 1961). Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=584762 on 2011-11-06
  2. ^ a b Wilson, B. (1994) Australian marine shells. Prosobranch gastropods. Vol. 2 Neogastropods. Odyssey Publishing, Kallaroo, Western Australia, 370 pp.
  • Filmer R.M. (2001). A Catalogue of Nomenclature and Taxonomy in the Living Conidae 1758 - 1998. Backhuys Publishers, Leiden. 388pp
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!