Overview

Brief Summary

Biology

The emperor scorpion engages in an elaborate courtship dance in which the male holds on to the female's pincers or chelicerae, and moves around to find a suitable place on the ground to deposit his spermatophore. Once deposited, he manoeuvres the female over the area so she can receive the sperm (4) (8) (9). The female gives birth to between 9 and 32 live young after a seven to nine month gestation period, and they remain with her for some time. The young are white when born, but darken with each moult, reaching sexual maturity at four months (3). The emperor scorpion shows a degree of social behaviour, with burrows often inhabited by 15 or more individuals (10). The emperor scorpion feeds on insects, arachnids, mice and small lizards, hunting them at night using its sensory hairs (trichobothria) (4). It has poor eyesight and is preyed upon by bats, birds, small mammals, large spiders, centipedes, large lizards and other scorpions (4) (7). As with other scorpions that possess large, strong pincers, the emperor scorpion uses the pincers to kill and manipulate prey, reserving the sting for larger prey or for use in self-defence (5) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The largest of scorpions, but not the longest, the emperor scorpion has a dark body ranging from dark blue/green through brown to black. The large pincers are blackish-red and have a granular texture. The front part of the body, or prosoma, is made up of four sections, each with a pair of legs. Behind the fourth pair of legs are comb-like structures known as pectines – these are longer in males and can be used by man to distinguish the sexes. The tail, known as the metasoma, is long and curves back over the body. It ends in the large receptacle containing the venom glands and tipped with the sharp, curved sting. Sensory hairs cover the pincers and tail, enabling the scorpion to detect prey through air and ground vibrations (3). When gravid (pregnant), the body of a female expands to expose the whitish membranes connecting the segments. The emperor scorpion fluoresces greenish-blue under ultraviolet light (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Emperor scorpions, Pandinus imperator, are native to west Africa and are predominantly found in forests of Nigeria, Togo, Sierra Leone, Ghana and the Congo region.

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The emperor scorpion is found in Africa, including Benin, Burkina Faso, Côte d'Ivoire, Ghana, Guinea, Togo, Liberia, Mali, Nigeria, and Sierra Leone (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Emperor scorpions are one of the largest species of scorpions in the world, measuring an average of 20 cm in length. They also tend to be heavier than other scorpions, and pregnant females can weigh more than 28 g. The body of the emperor scorpion is shiny black in color with two huge pedipalps (pincers) in the front, four legs and long tail (telson) ending in a stinger. Emperor scorpions have special sensory structures called pectines behind their limbs for sensing features of the terrain. Males usually have larger pectines than females. Like other arthropods, emperor scorpions undergo multiple molts. Their venom is mild and mainly used for defensive purposes; they generally use thier huge claws to kill prey. Like other scorpions, emperor scorpions give off a fluorescent bluish green appearance under UV light.

Range mass: 28 (high) g.

Average length: 20 cm.

Other Physical Features: ectothermic ; venomous

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Emperor scorpions are typically found in hot and humid forests. They reside in burrows and prefer to live under leaf litter, forest debris, stream banks and also in mounds of termites, their main prey. Emperor scorpions tend to live communally and are found in large numbers in regions of human habitation.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits both tropical forest and open savannas. The emperor scorpion burrows beneath the soil and hides beneath rocks and debris (3), and also often burrows in termite mounds (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Emperor scorpions typically eat insects and other arthropods and occasionally hunt down small vertebrates. They commonly eat termites. Adults generally do not kill their prey using their stinger but rather tear apart prey using their powerful pincers. Juveniles, however, depend on their stingers to kill prey.

Animal Foods: mammals; body fluids; insects; terrestrial non-insect arthropods

Primary Diet: carnivore (Eats terrestrial vertebrates, Eats body fluids)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Emperor scorpions eat a variety of insects and arthropods and are preyed upon by by birds, bats, spiders, and other mammals.

Ecosystem Impact: keystone species

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Emperor scorpions are eaten by many animals including birds, bats, mammals, and spiders.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The eyesight of emperor scorpions is very poor. Their other senses are well developed, with adaptations like the use of body hairs and pectines to detect the surrounding environment and prey.

Perception Channels: visual ; tactile ; vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Embryonic development of scorpions, including emperor scorpions, occurs in two ways, either apoikogenically or katoikogenically, and these methods differ in the amount of nutrition received from the mother. In apoikogenic development, ova have some yolk. Embryos use the yolk and receive some nourishment from the mother. In katoikogenic development, ova are without yolk, and embryos are nourished through a special feeding apparatus that develops early. Young embryos develop in the female ovariuterus or in specialized diverticula branching from the ovariuterus.

Most scorpions molt multiple times before becoming adults, though juveniles look like adults at all instars.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Emperor scorpions usually live 5 to 8 years in captivity. Lifespan is likely shorter in the wild.

Range lifespan

Status: captivity:
5 to 8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Emperor scorpions conduct elaborate mating rituals. Usually, the male grasps the female by pedipalps and engages in a myriad of behaviors including but not limited to sexual stinging and cheliceral "kissing" before depositing the sperm. Like some other arthropods, female emperor scorpions may kill and consume the male after mating has occurred.

Mating System: monogamous

Emperor scorpions breed throughout the year. After a gestation period of on average 9 months, females give live birth to 10 to 12 young. Emperor scorpions reach sexual maturity by 4 years of age.

Breeding season: Emperor scorpions breed throughout the year.

Range number of offspring: 10 to 12.

Range gestation period: 9 (low) months.

Average age at sexual or reproductive maturity (female): 4 years.

Average age at sexual or reproductive maturity (male): 4 years.

Key Reproductive Features: year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Emperor scorpions are born defenseless and rely heavily on their mother for food and protection. Newborns are carried on their mother's back until they are old enough to be on their own. Females are generally more aggressive after giving birth.

Parental Investment: female parental care ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pandinus imperator

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTATATATTTAGTTTTAGGAGGTTGAGCTTCTATGGTGGGTACGGCTTTAAGAATAATAATTCGTATTGAAACTGGGAGACCAGGGTCTTTTATTGGGGAC---GATCAGATTTATAATGTTGTTGTAACGGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATGCCTATTATGATTGGAGGTTTTGGGAATTGATTGGTCCCTTTGATGTTGGGGGCGCCTGATATAGCTTTTCCTCGGTTAAATAATATAAGATTTTGGTTGTTACCTCCTTCTCTTTTTCTTTTGTTAGGGTCCGTTGCTTTAGAAAGTGGGGCAGGTACTGGATGAACAGTTTACCCTCCTTTGTCTTCGAGTATGTTTCATTCGGGGGGCTCTGTTGACATGACTATTTTTTCTCTACATTTGGCTGGGGTTTCTTCGATTTTAGGGGCAATTAATTTTATTACTACTATTATTAATATGCGTAGAGAGGGAATGGTTATGGATCGAATTCCTTTATTTGTTTGATCGGTAATAGTTACTGCTATTTTGCTATTGTTGTCTCTTCCGGTATTGGCTGGGGCTATTACCATGTTGTTGACTGATCGTAATTTTAATACTTCATTTTTTGATCCTGCTGGTGGGGGGGATCCTGTTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pandinus imperator

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Emperor scorpions are listed in Appendix II by CITES. Species listed in Appendix II are not threatened, but trade is limited to prevent endangerment by human exploitation. Emperor scorpions are collected for the pet trade and for scientific study.

US Federal List: no special status

CITES: appendix ii

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

The emperor scorpion is listed on Appendix II of CITES (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The emperor scorpion is threatened by over-collection for the pet trade (3) (8) (11), and by continuing destruction of its habitat through deforestation (6) (8) (11). The relatively small litter sizes and long generation times typical of scorpions may mean populations take a long time to recover from any losses (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

The emperor scorpion was added to Appendix II of the Convention on International Trade in Endangered Species (CITES) due to concerns over the level of international trade in the species, and the potential effects on its populations. This listing means that international trade in the species should be carefully monitored and controlled, although those responsible for monitoring such trade are rarely scorpion experts, making identification of the different species a problem (1) (12). However, there is an increasing preference for captive-bred specimens in the pet trade (6), and this may go some way towards helping to prevent the emperor scorpion's decline.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The sting of emperor scorpions is generally mild and not fatal, but a pinch from their pedipalps is known to be painful.

Negative Impacts: injures humans (bites or stings, venomous )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Emperor scorpions are popular in the pet trade, as they are timid and their venom is mild. Many are imported for the pet trade from Ghana and Togo. They are often used in movies because of their spectacular appearance. The venom of emperor scorpions is also studied, as it is abundant in interesting peptides. A molecule called scorpine has been isolated from the venom of Emperor scorpines. The scorpine molecule seems to have anti-malarial and anti-bacterial qualities.

Positive Impacts: pet trade ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Emperor scorpion

Emperor scorpions exposed to ultra-violet light at Point Defiance Zoo & Aquarium

The emperor scorpion, Pandinus imperator, is a species of scorpion native to Africa. It is one of the largest scorpions in the world and lives for 5–8 years. Its body is black, but glows under ultraviolet light. It is a popular species in the pet trade, and is protected by CITES.

Contents

Description [edit]

The emperor scorpion (Pandinus imperator) is one of the largest species of scorpion in the world, with adults averaging about 20 centimetres (7.9 in) in length. However, some species of forest scorpions are fairly similar to the emperor scorpion in size, and one scorpion, Heterometrus swammerdami, holds the record for being the world's largest scorpion at 9 inches (23 cm) in length.[2] It is erroneously claimed to be the largest living scorpion in the world. However, some species of Forest Scorpions are its equal. [...] The Guinness Book of Records claims a Forest Scok. The large pincers are blackish-red and have a granular texture. The front part of the body, or prosoma, is made up of four sections, each with a pair of legs. Behind the fourth pair of legs are comb-like structures known as pectines, which tend to be longer in males than in females. The tail, known as the metasoma, is long and curves back over the body. It ends in the large receptacle containing the venom glands and is tipped with a sharp, curved stinger. Their sting is categorized as mild (similar to a bee sting) to severe on humans depending on the species.[3] Sensory hairs cover the pincers and tail, enabling the emperor scorpion to detect prey through vibrations in the air and ground.[4]

When gravid (pregnant), the body of a female expands to expose the whitish membranes connecting the segments. The emperor scorpion fluoresces greenish-blue under ultra-violet light.[5][6]

Habitat and distribution [edit]

The emperor scorpion is an African rainforest species.[7] It is found in a number of African countries, including Benin, Burkina Faso, Côte d’Ivoire, Gambia, Ghana, Guinea, Guinea-Bissau, Togo, Liberia, Mali, Nigeria, Senegal and Sierra Leone.[6]

This species inhabits both tropical forest and open savannas. The emperor scorpion burrows beneath the soil and hides beneath rocks and debris,[4] and also often burrows in termite mounds.[8]

Conservation and human impact [edit]

African Emperor scorpion venom contains a toxin called imperatoxin.[9]

P. imperator is a popular scorpion in the pet trade, which has led to such over-collecting in the wild that it is now a CITES-listed animal.[1]

References [edit]

This article incorporates text from the ARKive fact-file "Emperor scorpion" under the Creative Commons Attribution-ShareAlike 3.0 Unported License and the GFDL.
  1. ^ a b UNEP-WCMC. "Pandinus imperator (Koch, 1841)". UNEP-WCMC Species Database: CITES-Listed Species. Retrieved 11 June 2011. 
  2. ^ Manny Rubio (2000). "Commonly Available Scorpions". Scorpions: Everything About Purchase, Care, Feeding, and Housing. Barron's Educational Series. pp. 26–27. ISBN 978-0-7641-1224-9. "The emperor scorpion can reach an overall length of more than 8 inches (20 cm)." 
  3. ^ "Scorpion Emperor Care Sheet". Petco. 2004. Retrieved 2012-03-24. 
  4. ^ a b "Emperor Scorpion". The Animal Information Centre. March, 2005. 
  5. ^ "Emperor Scorpion". The Big Zoo. March, 2005. 
  6. ^ a b Emperor scorpion media at ARKive Accessed October 20, 2011.
  7. ^ Rod Preston-Mafham & Ken Preston-Mafham (1993). The Encyclopedia of Land Invertebrate Behaviour. Cambridge, Massachusetts: MIT Press. ISBN 978-0-262-16137-4. 
  8. ^ "Scorpion Systematics Research Group". American Museum of Natural History. November, 2008. Retrieved October 20, 2011. 
  9. ^ Fernando Z. Zamudio, Renaud Conde, Carolina Arévalo, Baltazar Becerril, Brian M. Martin, Hector H. Valdivia & Lourival D. Possani (1997). "The mechanism of inhibition of ryanodine receptor channels by imperatoxin I, a heterodimeric protein from the scorpion Pandinus imperator". Journal of Biological Chemistry 272 (18): 11886–11894. doi:10.1074/jbc.272.18.11886. PMID 9115249. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!