Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Lectotype for Melanoplus coloradus Caudell, 1903
Catalog Number: USNM 3220
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Male;
Preparation: Riker Mount
Collector(s): Dyar & Caudell
Year Collected: 1901
Locality: Palisades; Cal, California, United States
  • Lectotype: 1903. Proceedings of the United States National Museum. 26 (1333): 799, Pl. 55 Fig. 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Comments: Upland as well as lowland pastures, meadows, roadsides, low ground, cultivated fields as well as old fields, margins of woods and open woodlands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Melanoplus femurrubrum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACCTTATACTTTATATTTGGAGCATGAGCTGGAATAGTAGGAACTTCTATAAGAATAATTATTCGAGCAGAACTAGGACAACCAGGATCTCTAATTGGAGATGACCAAATCTATAATGTAATTATTACAGCCCACGCATTTGTAATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGACTTGTACCATTAATAATTGGAGCACCAGATATAGCTTTTCCACGAATAAATAATATAAGTTTTTGACTTTTACCACCATCACTAACCCTTTTACTTACCTCATCTATGGTTGATAATGGAGCTGGTACAGGATGAACAGTTTACCCCCCACTCGCTGGAGCAATTGCACATGGTGGAGCGTCAGTTGATTTAGCCATTTTCTCTCTTCACTTAGCTGGTGTTTCATCAATTCTAGGGGCAGTCAATTTTATTACAACAGCAATTAATATACGATCAGAAAGAATAACACTAGACCAAACACCATTATTTGTTTGATCAGTAGCTATTACAGCACTCCTTTTATTATTATCACTTCCTGTATTAGCAGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACATCATTCTTTGACCCTGCGGGAGGAGGTGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Melanoplus femurrubrum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Melanoplus femurrubrum

The Red-legged Grasshopper (Melanoplus femurrubrum) is a species of grasshopper belonging to the genus Melanoplus. It is found in Mexico, United States, and Canada.[1]

Description

This grasshopper has a reddish-brown back, a greeny-yellow belly, and red hind legs, hence its binomial name femurrubrum (femur = thigh, rubrum = red). They are approximately 2.5 cm long (1 inch).

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!