Molecular Biology and Genetics
Molecular Biology
Barcode data: Heterorhabditis bacteriophora
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
TCTGTTTGGTTAGAAAGTTCTAATCATAAAGATATCGGCACTTTATATTTTCTTTTTGGTTTGTGGTCTGGTATAGTAGGTACTAGTTTATCTTTAATTATTCGTTTAGAATTGGCTAAACCTGGTGTTTTTTTAGGTAAT---GGGCAGTTGTATAATTCTATTATTACAGCCCATGCTATTTTAATGATTTTTTTTATGGTGATACCTAGAATAATTGGGGGTTTTGGTAATTGGTTAGTTCCTTTGATGTTAGGAGCTCCTGATATGAGCTTCCCCCGTCTTAATAATTTAAGTTTTTGGTTATTACCCACTTCTATATTTTTGATTTTAGATGCGTGTTTTGTAGATATAGGTTGTGGTACTAGTTGAACTGTTTATCCACCTTTAAGA---ACTTTAGGTCATCCTGGAAGTAGGGTAGATTTAGCTATTTTTAGTCTTCATTGTGCTGGTTTGAGTTCAATTTTAGGAGGTATTAATTTTATAACTACTACAAGTAATTTACGTAGAAGTTCTATTTCTTTAGAACATATAAGGTTATTTGTTTGAACTGTGTTTGTTACTGTGTTCTTGTTAGTTTTATCTTTACCGGTTTTAGCGGGGGCTATTACTATATTGTTAACTGATCGTAATTTAAATACTTCTTTTTTTGATCCTAGTTCAGGTGGTAACCCTTTGGTTTATCAGCATTTATTTTGGTTCTTTGGGCATCCAGAAGTATATATTTTAATTTTACCAGCTTTTGGTATTATTAGTCAGTCAACTTTATATCTTACAGGTAAGAAAGATATTTTTGGGTTTATTGGTATAATTTATGCTATCTTAAGAATTGGTTTAATTGGTTGTGTAGTCTGAGCTCATCATATATATACAGTAGGTATAGATTTAGATTCTCGGG
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Heterorhabditis bacteriophora
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Wikipedia
Heterorhabditis bacteriophora
Heterorhabditis bacteriophora also known as beneficial nematodes is a species of nematode worm that is used in gardening. They are useful to thwart ants, fleas, moths, beetles, flies, beetles, and other pests. They release Xenorhabdus bacteria from their digestive tract thus killing these pests.[1]
References
- ^ "Natural pest control with beneficial nematodes". Gardeninsects.com. http://www.gardeninsects.com/beneficialNematodes.asp. Retrieved 2011-08-26.
 | This nematode- (or roundworm-) related article is a stub. You can help Wikipedia by expanding it. |
Source:
Wikipedia
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
