Overview

Brief Summary

Thelazia callipaeda, the Oriental Eye Worm, is one of two Thelazia spirurid nematodes (roundworms) that have been implicated in human infection (the other being T. californiensis). Dogs and other canids, cattle, and horses are the usual definitive hosts (the hosts in which the parasite matures and reproduces) for Thelazia nematodes (roundsworms), although other mammals, including cats, lagomorphs, cervids and humans, can also become infected. Adults reside in the conjunctival sac of the definitive host where they shed first-stage larvae. These larvae are sheathed. The first-stage larvae are ingested by the intermediate host (usually flies, including drosophilid flies in the genus Amioto and muscid flies in the genera Musca and Fannia) when they feed on tears and other lacrimal secretions. In the digestive tract of the intermediate host, the larvae shed the sheath and invade various host tissues, including the hemocoel, fat body, testis, and egg follicles, where they develop in capsules. The encapsulated larvae become infective L3 larvae after two molts. Afterwards, the L3 larvae break out of the capsules and migrate to the fly’s mouthparts, where they remain until the fly feeds on the tears of the definitive host. The larvae invade the conjunctival sac of the definitive host and become adults after about a month and two additional molts. Humans may also serve as a final host after infected flies feed on tears or other lacrimal secretions. The geographic distribution of these parasites is presumed to be worldwide. Human infections have been recorded from the United States, China, Russia, India, Japan, and Thailand.

(Centers for Disease Control Parasites and Health)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

The parasitic nematode Thelazia callipaeda is prevalent in dogs, cats, and humans in the former Soviet Union and in eastern Asia, including China, Korea, Burma, Japan, Indonesia, Thailand, Taiwan, and India (Neem 2011).

Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

The parasitic nematode Thelazia callipaeda infects the eyes of several vertebrate hosts including humans. This parasite requires a dipteran (fly) intermediate host, which also serves as a vector, delivering the parasite to the definitive vertebrate host (i.e., the host in a multi-host life cycle in within which reproduction occurs) when the fly lands around the vertebrate's eye and feeds on lachrymal secretions. (Neem 2011)  See EOL Thelazia page for more details.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thelazia callipaeda

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTGGTGGTTTTGGTAATTGGATATTACCTGTTATGCTGGGGGCTCCTGAGATGGCGTTTCCTCGTCTTAATGCTTTATCTTTTTGATTAACTTTTGTTGCTTTGTTGATAGTGTATCAGTCTTTTTTTATTGGTGGAGGAGCTGGAGGTAGTTGGACTTTTTATCCTCCTTTGAGA---GTAGAGGGGCAGCCTGGTGTGAGAATAGATTGTATAATTTTGGGGCTGCATACTGTAGGTATTGGTTCTTTGTTTGGAGCTATTAATTTTATGGTTACTACTCAAAACATGCGTTTAACTGCTGTTACTTTAGATCAGATAAGTATATTTGTTTGAACTTCTTATTTAACATCTTTTTTATTGATTTTATCTGTACCTGTGTTAGCTGGTTCTTTGTTGTTTTTGTTATTTGATCGTAATTTTAATTCTTCTTTTTATGATACTAAGAGGGGGGGTAGACCTTTATTGTTTCAGCATTTGTTTTGATTTTTTGGTCATCCAGAAGTTTATATTATTATTTTGCCGGCTTTTGGTATTATTAGGGAGGCAGTTTTGTTTTTGACTGATAAGGAACGTTTATTTGGTCAGGTTAGTATGACTTTTGCTTCAATTTGAATTGCTATTCTGGGAACTTCTGTTTGAGGTCACCATATATATACTGCAGGTTTGGATATTGATACTCGT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thelazia callipaeda

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

The parasitic nematode Thelazia callipaeda is one of the two Thelazia species known to infect humans, the other (typically infecting canids and several othe mammal hosts but occasionally infecting humans) being T. californiensis (Neem 2011).

Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Thelazia callipaeda

Thelazia callipaeda is a parasitic nematode, and the most common cause of "thelaziasis" (or "eyeworm" infestation) in humans, dogs and cats. It was first discovered in the eyes of a dog in China in 1910.[1] By 2000, over 250 human cases had been reported in the medical literature.[2]

Hosts[edit]

In addition to humans, cats and dogs, definitive hosts of T. callipaeda include the Wolf (Canis lupus), Raccoon dog (Nyctereutes procyonoides), Red Fox (Vulpes fulva), and European Rabbit (Oryctolagus cuniculus). This species has been found in China, France, Germany, India, Indonesia, Italy, Japan, Korea, the Netherlands, Russia, Switzerland, Taiwan and Thailand.[3]

Two intermediate hosts have been identified so far: Amiota (Phortica) variegata (Diptera: Drosophilidae) in Europe and Phortica okadai in China,[4] which feed on tears of humans and carnivores.[5] Some data suggests that only the males of A. (P.) variegata carry Thelazia callipaeda larvae.[6] This is noteworthy because in all other known cases of blood-feeding flies which transmit parasites, the parasites are carried by the females.[7]

Life cycle[edit]

The eggs of Thelazia callipaeda develop into first stage larvae (L1), in utero while the female is in the tissues in and around the eye of the definitive host.[8] The female deposits these larvae, which are still enclosed in the egg membranes, in the tears (lacrymal secretions) of the host. When a tear-feeding fly (intermediate host) feeds, it ingests the T. callipaeda larvae. Once inside the fly, the L1 larvae "hatch" from the egg membrane and penetrate the gut wall. They remain in the hemocoel (the fly's circulatory system) for 2 days, and then invade either the fat body or testes of the flies. In these tissues, the larvae develop into third stage larvae (L3). The L3 migrates to the head of the fly, and is released in or near the eye of a new host mammal when the fly feeds again. Once in the eye, eyelid, tear glands, or tear ducts of the mammalian host, the L3 larvae develop through the L4 larval stage and into adults in about 1 month. The seasonal timing of L1 and L4 larvae in the lacrymal (tear) secretions of naturally infested dogs in Italy was found to coincide with the activity of the fly vectors.[9]

Symptoms, diagnosis and treatment[edit]

Symptoms of T. callipaeda infestation include conjunctivitis, excessive watering (lacrimation), visual impairment, and ulcers or scarring of the cornea. In some cases, the only symptom is the worm obscuring the host's vision as a "floater".[10]

Diagnosis is made by finding the adult worms in the eye or surrounding tissues. Human cases are treated by simply removing the worms. In canines, topical imidacloprid with moxidectin,[11] or milbemycin oxime (Interceptor)[12] have been recommended.

References[edit]

  1. ^ Railliet, A.; Henry, A. (1910). "Les Thelazieo, Nematodes parasites de l'oeil". Comptes rendus des séances de la Société de biologie et de ses filiales 68: 213–216, 783–785. [verification needed]
  2. ^ Koyama, Y; Ohira, A; Kono, T; Yoneyama, T; Shiwaku, K (2000). "Five cases of thelaziasis". The British journal of ophthalmology 84 (4): 441. doi:10.1136/bjo.84.4.439c. PMC 1723424. PMID 10777285. 
  3. ^ Otranto, Domenico; Dutto, Moreno (Apr 2008). "Human Thelaziasis, Europe" (Free full text). Emerging Infectious Diseases 14 (4): 647–9. doi:10.3201/eid1404.071205. ISSN 1080-6040. PMC 2570937. PMID 18394285. 
  4. ^ Otranto, D; Lia, RP; Cantacessi, C; Testini, G; Troccoli, A; Shen, JL; Wang, ZX (2005). "Nematode biology and larval development of Thelazia callipaeda (Spirurida, Thelaziidae) in the drosophilid intermediate host in Europe and China". Parasitology 131 (Pt 6): 847–55. doi:10.1017/S0031182005008395. PMID 16336738. 
  5. ^ Otranto, D; Brianti, E; Cantacessi, C; Lia, RP; Máca, J (2006). "The zoophilic fruitfly Phortica variegata: morphology, ecology and biological niche". Medical and veterinary entomology 20 (4): 358–64. doi:10.1111/j.1365-2915.2006.00643.x. PMID 17199746. 
  6. ^ Otranto, D; Cantacessi, C; Testini, G; Lia, RP (2006). "Phortica variegata as an intermediate host of Thelazia callipaeda under natural conditions: evidence for pathogen transmission by a male arthropod vector". International Journal for Parasitology 36 (10–11): 1167–73. doi:10.1016/j.ijpara.2006.06.006. PMID 16842795. 
  7. ^ Otranto, D; Stevens, JR; Cantacessi, C; Gasser, RB (2008). "Parasite transmission by insects: a female affair?". Trends in Parasitology 24 (3): 116–20. doi:10.1016/j.pt.2007.12.005. PMID 18258484. 
  8. ^ Anderson, Roy C. (2000). "T. callipaeda Railliet and Henry, 1910". Nematode parasites of vertebrates: their development and transmission. Wallingford: CAB International. p. 405. ISBN 978-0-85199-421-5. OCLC 42080206. 
  9. ^ Otranto, D; Lia, RP; Buono, V; Traversa, D; Giangaspero, A (2004). "Biology of Thelazia callipaeda (Spirurida, Thelaziidae) eyeworms in naturally infected definitive hosts". Parasitology 129 (Pt 5): 627–33. doi:10.1017/S0031182004006018. PMID 15552407. 
  10. ^ Zakir, R; Zhong-Xia, Z; Chioddini, P; Canning, CR (1999). "Intraocular infestation with the worm, Thelazia callipaeda". The British journal of ophthalmology 83 (10): 1194–5. doi:10.1136/bjo.83.10.1194a. PMC 1722833. PMID 10636646. 
  11. ^ Bianciardi, P; Otranto, D (2005). "Treatment of dog thelaziosis caused by Thelazia callipaeda (Spirurida, Thelaziidae) using a topical formulation of imidacloprid 10% and moxidectin 2.5%". Veterinary Parasitology 129 (1–2): 89–93. doi:10.1016/j.vetpar.2004.12.020. PMID 15817208. 
  12. ^ Ferroglio, E; Rossi, L; Tomio, E; Schenker, R; Bianciardi, P (2008). "Therapeutic and prophylactic efficacy of milbemycin oxime (Interceptor) against Thelazia callipaeda in naturally exposed dogs". Veterinary parasitology 154 (3–4): 351–3. doi:10.1016/j.vetpar.2008.03.011. PMID 18456409. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!