Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Prairie provinces of Canada and the northern prairies of the United States. In the United States, also found in the high mountains of Colorado, New Mexico, Utah, and Arizona (Otte, 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Very similar to A. ARCTICUS, only other North American member of genus, but A. CLAVATUS has more distinctively clubed antennae. Antennae on A. ARCTICUS are only slightly enlarged and flattened (Otte, 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Gomphocerus carpenterii Thomas
Catalog Number: USNM 3049
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Male;
Preparation: Riker Mount
Locality: Colo., Colorado, United States
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Otte's (1981) comments are based on the work of Alexander and Hilliard who focused on Colorado populations. The primary food sources were grasses and sedges. Alpine populations also fed on the thistle Cirsium hookerianum.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

See Otte (1981) for a discussion of reproduction and life cycles.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aeropedellus clavatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCAGATATAGCCTTCCCACGAATAAATAATATGAGTTTCTGACTTCTACCACCATCATTAACTCTTTTGATTGCATCATCAATAGTTGATAGAGGTGCAGGAACAGGATGAACAGTTTATCCACCTCTTGCAAGAGCAATTGCTCATGGAGGAAGTTCAGTAGATCTC---GCTATTTTTTCATTACATTTAGCTGGTATTTCATCAATTTTAGGAGCAGTTAATTTCATTACAACCACAATCAATATACGATCTGAAAGAATAACACTGGATCAAACACCATTATTTGTTTGATCAGTAGCAATTACAGCACTATTATTACTTCTATCATTACCAGTACTAGCAGGA---GCAATCACTATATTATTAACTGATCGAAATTTAAATACATCATTCTTTGACCCAGCTGGAGGTGGAGACCCAATTCTTTATCAACATTTATTTTGATTCTTTGGACATCCTGAAGTTTACATTTTAATTTTACCAGGATTTGGTATTATTTCACATATTGTTTGTCAAGAAAGTGGAAAAATT---GAATCATTTGGAACTCTAGGAATAATTTATGCAATATTATCAATTGGATTAATAGGTTTTATTGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Aeropedellus clavatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!