Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: "Open bare roadsides, beaches and shorelines, playgrounds, and along railroad beds."

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dissosteira carolina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATACTTTATATTTGGAGCATGAGCAGGTATAGTTGGAACATCTATAAGAATAATTATTCGGGCTGAATTAGGGCAACCAGGATCTATGATTGGAGATGACCAAATTTATAATGTTATTATCACAGCACATGCATTTGTTATAATCTTCTTCATAGTTATACCAATCATGATTGGGGGTTTTGGAAATTGGCTAGTACCATTAATAATTGGGGCACCAGATATAGCATTTCCACGAATAAATAACATAAGATTTTGATTATTACCACCATCATTAATTTTACTACTCTCATCTAGAATAATTGATAGAGGGGTAGGTACAGGATGAACAGTCTACCCACCATTAGCAGGAGCAATTGCACATGGCGGGGCATCAGTAGATTTAGCTATTTTTTCACTACACTTAGCAGGTATTTCATCAATTTTAGGAGCAGTAAACTTCATTACAACAGCAATTAATATACGATCAGATAGAATAACTATAGATCAAACACCCTTATTTGTTTGATCAGTAGCAATTACAGCATTATTATTACTATTATCATTACCAGTTTTAGCTGGAGCAATTACAATACTATTAACAGACCGTAATATTAATACATCATTCTTTGATCCAGCTGGAGGTGGAGATCCAATCCTCTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dissosteira carolina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!