Overview

Brief Summary

The migratory locust (Locusta migratoria) is the most widespread locust species, and the only species in the genus Locusta. It occurs throughout Africa, Asia, Europe, Australia and New Zealand. While once common in Europe it has now become rare there. Because of the vast geographic area it occupies, which comprises many different ecological zones, numerous subspecies have been described. However, not all experts agree on the validity of some of these subspecies. Many other species of Orthoptera with gregarious and migratory behavior also go by the name 'locusts'. Locusta migratoria is a polyphenic species, that is, its pigmentation and size vary according to its "phase" (gregarious or solitary form) and its age. When population densities grow high the migratory locust appears in its smaller gregarious form, which is yellow to orange with black spots. In contrast, solitary form adults are brown or green, and tend to match the vegetation around them. Locusta migratoria in large population numbers can be economically devastating, as both larvae and adults eat huge quantities (adults daily eat their weight in food), and adults, as strong fliers, are highly mobile. Populations are monitored carefully to avoid and control plagues.

Wikipedia 2011a; Wikipedia 2011b

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

 

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Associations

Associations

Animal / parasite / endoparasite
sporont of Gregarina garnhami endoparasitises gut lumen of Locusta migratoria

Animal / parasite / endoparasite
cyst of Malamoeba locustae endoparasitises rectum of Locusta migratoria

Animal / parasite / endoparasite
larva of Mermis nigrescens endoparasitises body cavity of Locusta migratoria

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Swarms avoid collisions: locusts
 

Swarms of locusts avoid collisions with selective motion-detecting neurons.

       
  "Locusts, which can consume their own weight in food each day, have a  large neuron called the locust giant movement detector (LGMD) located  behind their eyes. The LGMD releases bursts of energy whenever a locust  is on a collision course with another locust or a predatory bird...The [European scientist] team found that the LGMD releases more energy when something is coming  directly at the locust. 

 "These spikes of energy, called action potentials, prompt the locusts to  take evasive action. The entire process from motion detection to  reaction takes about 45 milliseconds—or 45 thousandths of a second. 

 "'Locusts, like most insects, can see many more images per second than we  do. This means they can react in time to things that are approaching  very rapidly and so make their escape before collision,' Rind [Claire Rind, a biologist at the University of Newcastle upon Tyne in  England] said.

"And because the insects only detect things that are on a collision  course with them, the locusts are ignorant of all other movements. It's a  particularly useful trait, as the locusts travel in dense swarms akin  to rush hour traffic." (Roach 2004)
  Learn more about this functional adaptation.
  • Stafford, R.; Santer, R. D.; Rind, F. C. 2007. A bio-inspired visual collision detection mechanism for cars: Combining insect inspired neurons to create a robust system. BioSystems. 87: 164-71.
  • John Roach. 2004. Locusts inspire technology that may prevent car crashes. National Geographic News [Internet], Accessed March 25, 2010.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Ovipositor drills holes: locust
 

Ovipositors of locusts drill deep holes by use of two reciprocating rotating elements.

   
  "When females of locust species such as Locusta migratoria, Schistocerca gregaria (Forskal), S. peregrina (Olivier), Anacridium aegyptium and a number of other Acrididae dig oviposition holes, they stretch the intersegmental membranes between abdominal segments IV, V, VI and VII and thus make a hole considerably deeper than could otherwise be achieved. The ovipositor valves provide the force for this extension. The ovipositor is a boring machine which, once set in motion with its prongs against the soil, must automatically bury itself and in doing so it will stretch the easily extended abdomen to its full length, so long as the insect maintains it hold on the ground. The findings of the study provide an insight to the functioning of the locust apparatus, and suggested the possibility to develop an innovative digging system composed by two reciprocating rotating elements." (Courtesy of the Biomimicry Guild)
  Learn more about this functional adaptation.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Locusta migratoria

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 132 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMH1934-06|NC_001712|Locusta migratoria| CAAAAATGATTATTCTCAACAAACCACAAGGACATTGGTACACTGTATTTTATATTCGGGGCATGAGCTGGAATAGTAGGAACATCAATA---AGAATAATTATTCGAGCTGAATTAGGTCAACCAGGAACAATAATTAACGAT---GATCAACTATATAATGTAATCATTACAGCACACGCATTTGTTATAATTTTCTTCATGGTTATGCCAATTATAATTGGAGGATTCGGAAATTGATTAGTACCATTAATA---ATTGGAGCTCCAGATATAGCTTTTCCACGAATAAATAACATAAGATTTTGATTATTACCACCATCATTAACACTCCTACTAATGTCTTCTGTAGTAGATAATGGAGCTGGTACAGGATGAACAGTATATCCTCCACTAGCCAGAGTCATTGCTCATAGAGGAGCTTCTGTAGATTTA---GCAATTTTTTCATTACATCTAGCAGGTGTTTCCTCAATTTTAGGAGCTATTAATTTCATTACAACAGCAATCAATATACGATCAAATAATATAACCCTTGATCAAACACCATTATTTGTTTGATCAGTAGCAATTACAGCCTTATTACTTTTATTATCATTACCAGTATTAGCTGGA---GCAATTACTATATTATTAACTGATCGAAACCTTAATACGTCATTCTTCGACCCGGCAGGAGGAGGTGACCCAATTTTATATCAACACTTATTTTGATTCTTTGGTCACCCAGAAGTTTATATTTTAATTTTACCAGGATTTGGTATTATTTCACATATCGTTTGTCAAGAAAGAGGAAAAATT---GAATCATTTGGAACAATTGGTATAATTTATGCAATATTATCAATTGGATTAATAGGATTTATTGTATGAGCTCATCACATATTTACAGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Locusta migratoria

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 130
Species: 141
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Migratory locust

The migratory locust (Locusta migratoria) is the most widespread locust species, and the only species in the genus Locusta. It occurs throughout Africa, Asia, Australia and New Zealand. It used to be common in Europe but has now become rare there. Because of the vast geographic area it occupies, which comprises many different ecological zones, numerous subspecies have been described. However, not all experts agree on the validity of some of these subspecies.

Many other species of Orthoptera with gregarious and migratory behavior are indicated with the name of 'locusts'.

Contents

Polyphenism

The migratory locust is polyphenic. It transitions between two main phenotypes in response to population density; the solitary phase and the gregarious phase. As the density of the population increases the locust transforms progressively from the solitary phase towards the gregarious phase with intermediate phases:

Solitaire = solitary phase → transiens congregans (intermediate form) → gregarious phase → transiens dissocians (intermediate form) → solitaire = solitary phase.

Pigmentation and size of the migratory locust vary according to its phase (gregarious or solitary form) and its age. Gregarious larvae have a yellow to orange covering with black spots. Solitary larvae are green or brown. The gregarious adult is brownish with yellow, the latter colour becoming more intense and extensive on maturation. The solitary adult is brown with varying extent of green colour depending on the colour of the vegetation. Gregarious adults vary in size between 40 and 60 mm according to the sex. They are smaller than the solitary adults.

Economic Impact

Locusts are highly mobile, and usually fly with the wind at a speed of about 15-20 km/h. Swarms can travel 5-130 km or more in a day. Locust swarms can vary from less than one square kilometre to several hundred square kilometres with 40 to 80 million individuals per square kilometre. An adult locust can consume its own weight (about 2 grams) in fresh food per day. For every million locusts, one ton of food is eaten.

In Africa, the last serious widespread plague of Locusta m. migratorioides occurred from 1928 to 1942. Since then, environmental transformations have made the development of swarms from the migratory locust unlikely. However, the desert locust which is very similar to the African migratory locust remains a major threat. Nevertheless potential outbreaks are constantly monitored as plagues can be devastating.

Locust survey and control are primarily the responsibility of the Ministry of Agriculture in locust-affected countries and are operations undertaken by national locust units. The Food and Agriculture Organization (FAO) of the United Nations provides information on the general locust situation to all interested countries and gives warnings and forecasts to those countries in danger of invasion.

List of 'locusts'

Borderline species

Subspecies of Locusta migratoria

Gallery

See also

References

  • Walker, Annette, The Reed Handbook of Common New Zealand Insects, Reed Books, 2000 ISBN 0-7900-0718-5
  • Steedman, Alison (Ed.) 1988. Locust Handbook (2nd Edn). London: Overseas Development Natural Resources Institute, 180p. (ISBN 0-85954-232-7)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!