Overview

Brief Summary

Introduction

Gonatus berryi is a relatively common and distinctive species. It reaches a maximum size of at least 240 mm ML.

Diagnosis

A Gonatus with ...

  • club hooks proximal to the central hook that become larger toward the base of the club.
  • virtually no suckers in the medial region of the tentacular stalk.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Characteristics

  1. Arms
    1. Number of suckers in proximal half of each arm IV at 50 mm GL = about ??, and at 119 mm GL = about 45.

  2. Tentacles
    1. Clubs 30-37% of GL.
    2. Club dactylus with 4 sucker series becoming disorganized at dactylus base where sucker series split into those leading to the marginal zones of club.
    3. Club ventral-marginal zone with 3 series of suckers in central region; medial suckers ca. one-fourth diameter of suckers of marginal series. Occasionally 1-2 small suckers present as a partial fourth series.
    4. Club dorsal-marginal zone with few suckers in 1-2 irregular series.
    5. Club medial zone with large central hook; small distal hook and proximal series with 1-2 suckers followed proximally by 2-4 small hooks with largest hook never closest to large central hook (i. e. hooks initially increase in size proximally).
    6. Total number of suckers (excluding terminal pad, medial zone) on tentacular club: about 159-181.
    7. Median region of tentacular stalk between marginal series without suckers except for occasional 1-2 sucker.



    8. Figure. Oral views of the tentacle and club of G. berryi 119 mm GL, plesiotype. Top - Left tentacle. Middle- Enlargement of the tentacular club. Drawings from Young (1972). Bottom - Right tentacular club. Photograph by R. Young. The drawings have been inverted for easier comparison with the photograph.

  3. Head
    1. Beaks. Descriptions can be found here: Lower beak; upper beak. See also this site.

  4. Fins
    1. Fins large, ca. 50% of PL.

  5. Photophores
    1. Photophores absent

Comments

More details of the description of G. berryi can be found here.

G. berryi, in addition to the features listed above, can generally be recognized by the large size of the central hook, the large club manus and narrow dactylus and the somewhat more distal position of the central hook.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Type locality: Monterey Bay, California, eastern North Pacific. G. berryi is broadly distributed across the North Pacific.

Figure. Distribution of G. berryi. Dark pink area indicates known range; light pink area indicates inferred range. Chart modified from Okutani, et al. (1988).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

meso-bathypelagic
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 32 - 1400
  Temperature range (°C): 12.263 - 12.263
  Nitrate (umol/L): 7.162 - 7.162
  Salinity (PPS): 33.368 - 33.368
  Oxygen (ml/l): 5.636 - 5.636
  Phosphate (umol/l): 0.966 - 0.966
  Silicate (umol/l): 9.297 - 9.297

Graphical representation

Depth range (m): 32 - 1400
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Life History

The advanced paralarva of G. berryi at 8-10 mm ML has a spherical digestive gland rather than the spindle-shaped, obliquely-oriented digestive gland common to paralarvae of many (all?) other members of the genus.


Figure. Side view of a paralarva of G. berryi, 10 mm ML. Drawing from Young (1972).

The size of the juvenile at which the various hooks first develop is often distinctive of the species.


Figure. Chart of the size ranges over which hooks in juveniles of G. berryi first appear. Chart modified from Young (1972).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gonatus berryi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACATTATATTTTATCTTTGGTATTTGAGCAGGTCTACTAGGAACCTCCCTAAGCCTAATAATTCGAACTGAATTGGGGCAACCTGGCTCTCTACTAAACGAC---GATCAACTTTATAACGTTGTAGTCACAGCCCATGGATTTATCATAATTTTTTTTTTAGTCATGCCTATCATAATTGGAGGATTTGGTAATTGACTTGTACCCTTAATACTAGGAGCCCCAGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCTTCCTTAACATTACTACTAGCTTCCTCAGCCGTTGAAAGAGGGGCAGGTACAGGATGAACAGTCTACCCCCCTCTTTCTAGCAACTTATCTCATGCAGGCCCTTCAGTTGATTTAGCCATTTTTTCTTTACATTTAGCAGGTGTATCCTCCATTCTAGGAGCCATTAACTTCATTACTACAATTTTAAACATGCGGTGAGAAGGGTTACAAATGGAACGACTGCCCCTTTTTGCTTGATCTGTGTTTATTACCGCAATCTTACTACTTTTATCACTTCCTGTTTTAGCCGGAGCTATTACTATACTACTAACTGACCGAAACTTTAACACAACCTTTTTTGATCCTAGGGGAGGAGGAGACCCTATCTTATACCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gonatus berryi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!