Overview

Brief Summary

Introduction

Gonatus onyx is a small and common species of Gonatus. Spent females reach a size of 132-145 mm ML (Seibel, et al., 2000).

Diagnosis

A Gonatus with ...

  • a single hook on the tentacular club.
  • usually less then 10 suckers in the medial zone of the tentacular stalk.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Characteristics

  1. Arms
    1. Total of 25-30 hooks and suckers present on proximal half of each arm I-III; squid >40 mm GL with 30-37 suckers on proximal half of each arm IV.

  2. Tentacles
    1. Clubs 20-25% of GL.
    2. Club dactylus with 5-6 irregular series at proximal end but quickly decreasing to 4 series; over most of dactylus suckers in transverse series approximately equal in size.
    3. Club ventral-marginal zone with 4 (rarely 5) series of suckers in central part; suckers of medial suckers ca. one-half diameter of suckers of marginal series.
    4. Club dorsal-marginal zone with 2-3 irregular series dorsal to large central hook.
    5. Club medial zone with large central hook and proximal series of suckers; proximal suckers never transformed into hooks. Usually no zone member distal to central hook, occasionally large sucker present that may bear a large tooth; rarely a small hook present but usually on just tentacle.
    6. Total number of suckers (excluding terminal pad and medial zone) on tentacular club: about 160-200.
    7. Median region of tentacular stalk between marginal series with ca. 0-27 suckers (usually less than 10) scattered suckers.



    8. Figure. Oral view of the tentacle of G. onyx, 69 mm GL. Top - Distal region of tentacle. Middle - Enlargement of club from top figure. Drawings from Young (1972). Bottom - Right tentacular club, paratype, 98 mm ML, female. Photograph by R. Young.

  3. Head
    1. Beaks: Descriptions can be found here: Lower beak; upper beak. See this site also.

  4. Photophores
    1. Photophores absent

Comments

More details of the description can be seen here.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type locality: 33°19'N, 118°45'W, eastern North Pacific off Southern California. G. onyx is broadly distributed across the North Pacific.


Figure. Distribution of G. onyx. Dark pink area indicates known range; light pink area indicates inferred range. Chart modified from Okutani, et al. (1988).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Paratype for Gonatus onyx Young, 1972
Catalog Number: USNM 727489
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: ; larvae
Preparation: Alcohol (Ethanol)
Year Collected: 1962
Locality: Southern Area, California, United States, North Pacific Ocean
Depth (m): 767 to 767
Vessel: Velero IV R/V
  • Paratype: Young, R. 1972. Smithson. Contrib. Zool. 97: 43-46, pls. 13,14,17.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

epi-bathypelagic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 12 specimens in 1 taxon.
Water temperature and chemistry ranges based on 5 samples.

Environmental ranges
  Depth range (m): 5 - 1289
  Temperature range (°C): 9.072 - 12.263
  Nitrate (umol/L): 7.162 - 21.256
  Salinity (PPS): 33.264 - 33.765
  Oxygen (ml/l): 3.201 - 5.636
  Phosphate (umol/l): 0.966 - 1.898
  Silicate (umol/l): 9.297 - 26.259

Graphical representation

Depth range (m): 5 - 1289

Temperature range (°C): 9.072 - 12.263

Nitrate (umol/L): 7.162 - 21.256

Salinity (PPS): 33.264 - 33.765

Oxygen (ml/l): 3.201 - 5.636

Phosphate (umol/l): 0.966 - 1.898

Silicate (umol/l): 9.297 - 26.259
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Life History

Gonatus onyx females brood their young in deep water. Five females have been observed with an ROV carrying large egg masses at depths of 1539 -2522 m in Monterey canyon off California (eastern North Pacific). The black egg mass, with 2000-3000 eggs, is a hollow tube open near the mouth and at the distal end. The gelatinous tube walls consist of double membranes that join together forming a single-layer honeycomb with a single egg in each chamber of the honeycomb. Regular movements of the arms (every 30-40 sec) flush water through the egg mass to aerate the embryos. The black color of the egg mass probably comes from ink released by the female (Seibel et al. 2000; Seibel, et al. 2005).

A video of one of the brooding squid observed by Seibel, et al. 2005, can be seen here. The video starts slowly but is impressive near the end. The embryos were ready to hatch and, peerhaps, the disturbance created by the ROV stimulated hatching.

Water temperatures where the females were observed varied between 1.7 - 3.0°C and at these temperatures the embryos may require as long as 6-9 months to develop. Brooding females lack tentacles, hold onto the egg mass with arm hooks,and apparently don't feed during brooding. High lipid content of the digestive gland and protein in the mantle muscle of the female presumably fuel the metabolism through this long brooding period. Observations of declines in these fuels and female activity with increasing stage of embryonic development support this assumption(Seibel et al. 2000; Seibel, et al. 2005).

Observation of a brooding gonatid in shallow water in the Sea of Okhotsk (Okutani, 1995) combined with the distance required for hatchlings to reach their surface habitat from the brooding sites off California suggests that females transport the egg masses to near-surface waters at the time of hatching (Seibel et al. 2000).

Figure. Left - Ventrolateral view of G. onyx brooding a mass of eggs at a depth of 1539 m in Monterey Canyon off California. ROV photograph from Seibel et al. (2005), © 2002 MBARI. Right top - Frontal and cross-sectional views of pieces of an egg mass of G. onyx. Right bottom - Side view of a hatchling from the egg mass. The club has 70-90 sucker buds. Drawings from Seibel, et al. (2000).

Figure. Laboratory hatchling of G. onyx from a captured egg mass, ca. 3 mm ML. Photograph from Seibel, et al. (2005).

Paralarvae collected in the plankton can be identified by the dorsal-head chromatophore pattern which is Type II-1 [three transverse rows of chromatophores with one chromatophore in the anterior row (this is missing, hence the "-1" attached to "Type II"), two in the middle row and three in the posterior row]; the mantle has one dorsal and four lateral chromatophores (Jorgensen, 2006).


Figure. Dorsal views of the chromatophores of a G. onyx paralarva, 8.9 mm ML, Gulf of Alaska. Left - Head. Right - Paralarva. Drawing from Jorgensen (2007).

We have seen two young G. onyx, 38 and 31 mm ML, with mantle chromatophores intact, that show several, large chromatophores on each side of the mantle (see photograph below). These chromatophores were even more pronounced in the preserved specimens and may prove to have systematic value. At 31 mm ML the squid had virtually no chromatophores on its ventral surface of the mantle but abundant mantle chromatophores elsewhere.


Figure. Dorsolateral view of a barely alive G. onyx, 38 mm ML, off Monterey, California, showing the large, lateral, mantle chromatophores (arrows). © Danté Fenolio

The size of the juvenile at which the various hooks first develop is often distinctive of the species.

Figure. Chart of the size ranges over which hooks in juveniles of G. onyx first appear. Chart modified from Young (1972).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gonatus onyx

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACATTATATTTTATCTTTGGTATTTGAGCAGGTCTTCTAGGAACCTCCCTAAGCCTAATAATTCGAACTGAATTAGGTCAACCTGGCTCTCTACTAAACGAT---GATCAACTCTACAATGTTGTAGTTACAGCCCATGGATTTATCATAATTTTTTTTTTAGTAATACCTATTATAATTGGAGGATTTGGTAATTGACTTGTTCCCTTAATACTAGGAGCCCCAGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGATTACTTCCTCCTTCCTTGACACTATTATTAGCTTCCTCAGCAGTTGAAAGAGGGGCAGGGACAGGATGAACCGTTTATCCCCCTCTTTCTAGTAATTTATCTCATGCAGGCCCTTCAGTTGATTTAGCCATTTTTTCTTTACATTTAGCTGGAGTTTCCTCTATTCTAGGAGCCATTAATTTCATTACTACAATTTTAAATATGCGATGAGAAGGGCTACAAATAGAACGGCTACCCTTATTTGCTTGATCTGTATTTATTACTGCAATTTTACTACTCCTATCTCTTCCTGTTCTTGCTGGAGCGATTACTATATTATTAACTGACCGAAATTTTAACACAACTTTTTTTGACCCAAGGGGAGGGGGGGATCCTATCTTGTACCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gonatus onyx

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Gonatus onyx

Gonatus onyx, also known as the clawed armhook squid or black-eyed squid, is a squid in the family Gonatidae. It occurs in the northern Pacific Ocean from Japan to California.[1]

G. onyx grows to 18 cm in mantle length.[2]

The type specimen was collected off California and is deposited at the Santa Barbara Museum of Natural History.[3]

References

  1. ^ Norman, M.D. 2000. Cephalopods: A World Guide. ConchBooks.
  2. ^ Okutani, T. 1995. Cuttlefish and squids of the world in color. Publication for the 30th anniversary of the foundation of the National Cooperative Association of Squid Processors.
  3. ^ Current Classification of Recent Cephalopoda
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!