Physical Description

Diagnostic Description

E2 [endemic to California floristic province (Hickman, 1993)]

 

Near L. umbratus ; known only from queens and males.

License not applicable

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

These ground-nesting ants also tend to prefer cooler habitats at middle to high elevations. Workers are generalized scavengers and often tend hemipterans. Species in the subgenera Acanthomyops and Chthonolasius are temporary social parasites on other Lasius species. Species of Acanthomyops were previously considered to represent a different genus, but are now known to be phylogenetically nested within Lasius (see above under “Taxonomic Changes”).

 

Species identification: keys in Wilson (1955a), Wing (1968) ( Acanthomyops ), and Mackay and Mackay (2002). Additional references: Agosti and Bolton (1990b), Cole (1956a, 1958a), Hasegawa (1998), Janda et al. (2004), MacKay (1998), Savolainen (2002), Seifert (1988a, 1992b), Umphrey and Danzmann (1998), Wheeler and Wheeler (1986g).

License not applicable

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Lasius (A) pogonogynus Buren
Catalog Number: USNM 59032
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Year Collected: 1933
Locality: Red Feather Lakes; Colo, Colorado, United States
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Associations

In Great Britain and/or Ireland:
Animal / sequestrates
female of Lasius meridionalis takes over nest of Lasius

Animal / sequestrates
female of Lasius sabularum takes over nest of Lasius

Animal / sequestrates
queen (newly mated) of Lasius umbratus takes over nest of Lasius

Animal / predator
adult of Solenopsis fugax is predator of brood of Lasius
Other: major host/prey

Animal / guest
larva of Xanthogramma is a guest in nest of Lasius

Animal / guest
larva of Xanthogramma citrofasciatum is a guest in nest of Lasius

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lasius cf. hayashi MMANTa40

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTATTTTTTCTCTTCATATTGCTGGGATATCTTCTATTCTAGGAGCTATCAACTTTATTTCAACTATTATAAATATACACCATAAAAATTTTTCTATTGATAAAATTCCCTTACTTGTATGGTCAATTTTAATCACTGCAATTTTATTACTATTATCCCTTCCAGTTCTTGCGGGA---GCTATTACTATACTTCTAACTGACCGTAACCTTAATACTTCATTTTTTGACCCCTCTGGCGGGGGAGATCCTATTTTATATCAACATCTCTTCTGATTTTTTGGACACCCTGAAGTTTATATTTTAATTCTCCCTGGATTTGGACTAATTTCTCATATTATTATAAATGAAAGAGGAAAAAAA---GAAACATTTGGATCTTTAGGAATAATTTATGCTTTAATAGCAATTGGATTTTTAGGATTTGTTGTATGAGCTCACCATATATTTACTATTGGTTTAGATGTTGATACTCGAGCATATTTCACCTCTGCAACTATAATTATTGCTATTCCAACTGGAATCAAAATTTTTAGATGAATTACT---ACTCTCCATGGTACA---AAAATCAATAATAATTCTTCCTTATGATGAGCAATAGGATTTATCTTCTTATTCACTATAGGAGGTTTAACAGGAGTAATACTTTCAAATTCATCAATTGATATTATTCTCCATGACACTTATTACGTAGTAGCTCATTTCCATTATGTA---TTATCAATAGGAGCAGTATTTGCTATTATTGCCAGATTTATTCACTGATTTCCCTTAATAACTGGTTTCTCTTTAAATAATTTTTTCTTAAATATTCAATTTATTTGTATATTCTTTGGAGTCAATTTAACATTTTTTCCTCAACATTTTTTAGGTTTAAGAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lasius cf. hayashi MMANTa40

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:882Public Records:157
Specimens with Sequences:743Public Species:36
Specimens with Barcodes:717Public BINs:10
Species:54         
Species With Barcodes:49         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Lasius

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Lasius

Lasius is a genus of boreal formicine ants.[1] The type species for this genus is the black garden ant, Lasius niger. Other major members, which live in drier heathland, are the cornfield ant, L. neoniger, and L. alienus

Other species include the temporary social parasites of the L. mixtus group and the hyper-social parasite Lasius fuliginosus.

Lasius flavus is also a commonly seen species, building grassy hillocks in undisturbed pasture. In the Alps, these mounds - always aligned east to catch the first rays of the rising sun - have been traditionally used by goatherds as natural compasses.

The genus was renamed by Horace St. John Kelly Donisthorpe, the eccentric British myrmecologist and coleopterist, after himself Donisthorpea.

Synonyms: Donisthorpea Donisthorpe

Contents

Moisture ants [edit]

Many Lasius species, known collectively as "moisture ants" in the United States, make their nests in and around moist rotting wood as well as under rocks.[2][3] They can infest buildings, particularly foundation forms in contact with soil, becoming a minor nuisance.[4][2] They are not considered a structural threat because they only make their galleries in wood that is already decayed.[4] Some species build "cartonlike" nests in moist locations made of decayed wood fragments cemented together with honeydew and the ant's mandibular gland secretions.[3] Workers are monomorphic, 2 to 3 mm long, yellow to dark brown.[2] They are secretive, and forage mostly at night for honeydew and other sweet substances, and may also prey on small insects.[2] Winged reproductive males and females swarm in late summer and fall, which is when building infestations may be noticed.[2] They are distinguished from carpenter ants (Camponotus), another structure-infesting species, by being much smaller, and having a notch in the dorsal thorax (top of the center body division), where carpenter ants have a rounded thorax.[4][2] Widespread moisture ant species include L. alieni and L. neoniger, as well as some Acanthomyops species.[3]

Species [edit]

Lasius niger, queen, workers, and eggs
Cornfield ant, Lasius alienus
Lasius flavus
Source: Catalogue of Life: 2005 Annual Checklist

References [edit]

  1. ^ "Genus: Lasius". AntWeb. Retrieved 02-05-12. 
  2. ^ a b c d e f Klotz, John H. (2010). Urban Pest Management of Ants in California. UCANR Publications, Division of Agriculture and Natural Resources, University of California. pp. 54–55. ISBN 1601076649. 
  3. ^ a b c Klotz, John H. (2008). Urban Ants of North America and Europe: Identification, Biology, and Management. Cornell University Press. pp. 39–44. ISBN 0801474736. 
  4. ^ a b c Antonelli, Art (2007). "Extension Bulletin 1382: Moisture Ants". WSU Extension. Washington State University. Retrieved March 4, 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!