Overview

Comprehensive Description

Genus Lasius HNS Fabricius, 1804

Lasius HNS Fabricius, 1804:415.

Type-species: Formica nigra Linne HNS , 1758.

The antennae are 12 segmented in the worker and female, 13 segmented in the male. The antennal insertions are situated at the posterior margin of the clypeus and segments2 to 5 are not longer than the succeeding segments. Maxillary palps are 6 segmented, labial palps 4 segmented. The head of the worker caste is somewhat cordate with a posterior emargination in some species. The clypeus is broad and rounded anteriorly. The frontal carinae are short and sub-parallel and in most species the frontal triangle is indistinctly defined. The orifice of the propodeal spiracle is circular or broadly oval situated close to the posterior propodeal border. Ocelli are minute or indistinct in the worker but distinct in the female and male. The petiole is vertical and scale-like in most species.

This genus contains about 42 species with a holarctic distribution. It was extensively revised by Wilson (1955). Members of this genus are predominantly aphidicolous but also carnivorous and scavenging. There are 14 species in Europe of which IO are known to occur in Fennoscandia.

Keys to species of Lasius HNS

Workers

1 Colour shining black; head large, broadly cordate with a distinct posterior emargination (Fig. 137)............................................... 37. fuliginosus (Latreille) HNS

Colour greyish or brownish black or yellow..................................................... 2

2(1) Colour yellow to brownish yellow; maximum eye length 1/4, head width or less ... 3

Colour brownish or greyish black or somewhat bicoloured reddish and black; maximum eye length more than head width ................................................ 8

3 (2) Petiole nodal with dorsal crest in front view strongly convex; head emarginatc posteriorly; with genal margins rounding in towards close set mandibular insertions(Figs. 153,155)....................................................... 42. carniolicus (Mayr) HNS

Petiole with thin dorsal crest, straight or emarginate in front view; back of head convex and genal margins not pronouncedly sloping in towards mandibular insertions which are wide set.......................................................................... 4

4 (3) Front tibiae and antennal scapes with sub-erect hairs standing out clearly from general pubescence....................................................................................... 5

Front tibiae and antennal scapes with pubescence only.................................... 6

5 (4) Scapes and tibiae flattened with thin front edge; petiole scale narrowly rec- tangular.................................................................. 39. meridionalis (Bondroit) HNS

Scapes and tibiae rounded elliptical in cross section; petiole scale with curving sides and more or less emarginate dorsal border........... 38. umbratus (Nylander) HNS

6 (4) Body hairs short, erect hairs on first gaster tergite x 0.3 or less hind tibial width (Fig. 149)....................................................................... 41. mixtus (Nylander) HNS

Body hairs long, erect hairs on first gaster tergite x 0.7 or more hind tibial width............................................................................................................ 7

7 (6) Petiole narrow with deep semicircular emargination; erect hairs on gaster restricted to hind borders of tergites (Fig. 147)................... 40. bicornis (Forster) HNS

Petiole broad with dorsal crest widely emarginate or straight; erect hairs arise all over dorsum of gaster (Fig. 124)................................... 33. flavus (Fabricius) HNS

8 (2) Front tibiae and antennal scapes with abundant semi-erect hairs 36. niger (Linne) HNS

Front tibiae and scapes bare (or with occasional oblique hairs standing out from general pubescence)...................................................................................... 9

9 (8) Body bicoloured with head and alitrunk pale brownish red contrasting with darker gaster; occipital corners without projecting hairs; ocelli usually visible and frontal furrow clearly demarcated (Fig. 131)............ 35. brunneus (Latreille) HNS

Body evenly brownish or greyish black; occipital corners with projecting hairs; ocelli not visible and frontal furrow usually indistinct (Fig. 130) 34. alienus (Forster) HNS

Queens

1 Colour shining black; orifice of metapleural gland without guard hairs; head broadly emarginate and wider than alitrunk; scutum overhangs the pronotal convexity (Fig. 136).................................................... 37. fuliginosus (Latreille) HNS

Colour various from yellowish brown to brownish or greyish black; orifice of metapleural gland with guard hairs; pronotal convexity not covered by scutum:

2 (1) Front tibiae and antennal scapes with standing hairs........................................ 3

Front tibiae and scapes with pubescence but no standing hairs......................... 5

3 (2) Head distinctly narrower than alitrunk at its widest point; eyes without short hairs between facets; colour greyish black .............................. 36. niger (Linne) HNS

Head broader than alitrunk; eyes with short hairs; body colour yellowish brown to brownish black ............................................................................... 4

4 (3) Antennal scapes and tibiae flattened with thin front edge: minimum hind tibial width x 0.5-0.6 maximum width. Petiole scale rectangular in front view; funiculus segments distinctly elongate; sculpture fine and pubescence thin so that general appearance, especially frons, shining; colour brownish black (Figs. 144, 145)........................................................ 39. meridionalis (Bondroit) HNS

Antennal scapes and tibiae oval: minimum hind tibial width x 0.75 maximum width. Petiole scale with rounded sides; hexagonal in frontal view, with distinctly emarginate dorsal crest; sculpture and pubescence somewhat coarse so that general appearance somewhat dull; colour yellowish brown to dark mahogany brown (Figs. 140,141)................................................. 38. umbratus (Nylander) HNS

5 (2) Eyes without short hairs between facets, or one or two at most.........................6

Eyes with numerous short hairs...................................................................... 7

6 (5) Body colour greyish black; head distinctly narrower than alitrunk; frontal triangle usually indistinct; wings clear, not infuscated .......... 34. alienus (Forster) HNS

Body colour brownish black: head more massive, nearly as broad as maximum width of alitrunk; median furrow and frontal triangle always clearly demarcated; wings infuscated basally...................................... 35. brunneus (Latreille) HNS

7 (5) Head distinctly narrower than alitrunk ............................. 33. flavus (Fabricius) HNS

Head as broad or broader than alitrunk .......................................................... 8

8 (7) Petiole very convex in front view; head with rounded occipital lobes and convex genal margins................................................................. 42. carniolicus (Mayr) HNS

Petiole with thin scale-like dorsal crest; back of head straight or weakly concave; genal margins straight or very slightly convex.................................................. 9

9 (8) Gaster with short hairs only, x 0.3 maximum tibial width or less; scale weakly emarginate; size larger -length: 6.0-7.5 mm..................... 41. mixtus (Nylander) HNS

Gaster with long hairs, as long as tibial width; scale deeply incised; size smaller - length: 4.5-5.5 mm ......................................................... 40. bicornis (Forster) HNS

Males

1 Suberect hairs present on either extensor tibial surface or antennal scapes or both ......................................................................................................... 2

Tibiae and scapes with pubescence only ......................................................... 4

2 (1) Mandibles with apical tooth only, masticatory border smoothly rounded into pre-apical cleft; head distinctly narrower than alitrunk ............ 36. niger (Linne) HNS

Masticatory border with distinct teeth; head massive relative to alitrunk, as wide or wider................................................................................................ 3

3 (2) Frons shining with fine microsculpture and thin pubescence; frontal groove and frontal triangle well marked; mandibles with very well defined teeth; body colour evenly black; cross vein m-cu frequently absent on fore-wing (Fig. 146) 39. meridionalis (Bondroit) HNS

Frons somewhat dull with coarse microsculpture and thick pubescence; frontal groove and triangle often indistinctly defined or obscured by pubescence; denticles less sharply defined; body colour brown to brownish black; cross vein m-cu usually present (Fig. 142)............................. 38. umbratus (Nylander) HNS

4(1) Mandibles with a single apical tooth............................................................... 5

Mandibles with a distinct pre-apical tooth or denticles as well as an apical tooth 7

5 (4) Shining black; head large; distinctly emarginate posteriorly; metapleural gland lacking guard hairs (Fig. 138) ...................................... 37. fuliginosus (Latreille) HNS

Colour grey to brownish black; head border convex or straight; metapleural gland with guard hairs ................................................................................... 6

6 (5) Projecting hairs absent on occipital corners of head; pre-apical cleft of man- dible clear, wings fuscous on basal half (Fig. 132)............ 35. brunneus (Latreille) HNS

Head above eyes fringed with projecting hairs; pre-apical cleft of mandibles shallow; basal angle of mandible broadly rounding into edentate masticatory border; wings clear............................................................ 34. alienus (Forster) HNS

7 (4) Petiole thickened in side view, with broadly rounded dorsal crest; back of head with numerous projecting hairs (Fig. 154)......................... 42. carniolicus (Mayr) HNS

Petiole thin in side view, with emarginate or flat dorsal crest; back of head with occasional hairs only.............................................................................. 8

8 (7) Head width less than maximum alitrunk width; mandibles with apical and one pre-apical tooth only; cross vein m-cu often absent on one or both fore wings (Fig. 127)........................................................................ 33. flavus (Fabricius) HNS

Head width as wide as alitrunk; mandibles either denticulate evenly or with at least one or more denticles in addition to apical and pre-apical teeth; cross vein m-cu normally present............................................................................ 9

Figs. 124-127. Lasius flavus (Fabr.) HNS . - 124: worker in profile; 125: petiole scale of queen in anterior view; 126: head of worker in dorsal view; 127: head of male in dorsal view. Scale: 1 mm.

9 (8) Petiole scale high, narrow, and deeply incised; masticatory border with well defined denticles; size small - length: 3.2 mm.................... 40. bicornis (Forster) HNS

Petiole scale broad, with straight or slightly emarginate dorsal crest; masticatory border with one or two denticles only, the rest obscure or absent; larger length: 3.7-4.5 mm (Fig. 152)........................................ 41. mixtus (Nylander) HNS

  • Collingwood, C. A. (1979): The Formicidae (Hymenoptera) of Fennoscandia and Denmark. Fauna Entomologica Scandinavica 8, 1-174: 92-96, URL:http://antbase.org/ants/publications/6175/6175.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genus Lasius Fabricius HNS

These ground-nesting ants also tend to prefer cooler habitats at middle to high elevations. Workers are generalized scavengers and often tend hemipterans. Species in the subgenera Acanthomyops HNS and Chthonolasius HNS are temporary social parasites on other Lasius HNS species. Species of Acanthomyops HNS were previously considered to represent a different genus, but are now known to be phylogenetically nested within Lasius HNS (see above under “Taxonomic Changes”).

Species identification: keys in Wilson (1955a), Wing (1968) ( Acanthomyops HNS ), and Mackay and Mackay (2002). Additional references: Agosti and Bolton (1990b), Cole (1956a, 1958a), Hasegawa (1998), Janda et al. (2004), MacKay (1998), Savolainen (2002), Seifert (1988a, 1992b), Umphrey and Danzmann (1998), Wheeler and Wheeler (1986g).

  • Ward, P. S. (2005): A synoptic review of the ants of California (Hymenoptera: Formicidae). Zootaxa 936, 1-68: 29-29, URL:http://antbase.org/ants/publications/21008/21008.pdf
Public Domain

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genus Lasius Fabricius HNS

A close relationship between Acanthomyops Mayr HNS and Lasius HNS has long been recognized (Creighton 1950a, Wilson 1955a, Wing 1968a). Recent molecular studies (Savolainen 2002, Janda et al. 2004) demonstrate that Acanthomyops HNS is nested phylogenetically within Lasius HNS . To maintain monophyly for Lasius HNS , Acanthomyops HNS cannot be treated as a separate genus. It is here returned to the status of subgenus ( stat. rev. ) in Lasius HNS , which generates revised or new combinations in Lasius HNS for the following species names: arizonicus HNS comb. rev. , bureni HNS comb. nov. , californicus HNS comb. rev. , claviger HNS comb. rev. , clavigeroides HNS comb. rev. , colei HNS comb. nov. , coloradensis HNS comb. rev. , creightoni HNS comb. nov. , interjectus HNS comb. rev. , latipes HNS comb. rev. , mexicanus HNS comb. rev. , murphyi HNS comb. rev. , occidentalis HNS comb. rev. , parvula HNS comb. rev. , plumopilosus HNS comb. rev. , pogonogynus HNS comb. rev. , pubescens HNS comb. rev. , and subglaber HNS comb. rev.

  • Ward, P. S. (2005): A synoptic review of the ants of California (Hymenoptera: Formicidae). Zootaxa 936, 1-68: 13-13, URL:http://antbase.org/ants/publications/21008/21008.pdf
Public Domain

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lasius HNS sp. CA-01

E2 [endemic to California floristic province (Hickman, 1993)]

Near L. umbratus HNS ; known only from queens and males.

  • Ward, P. S. (2005): A synoptic review of the ants of California (Hymenoptera: Formicidae). Zootaxa 936, 1-68: null, URL:http://antbase.org/ants/publications/21008/21008.pdf
Public Domain

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

E2 [endemic to California floristic province (Hickman, 1993)]

 

Near L. umbratus ; known only from queens and males.

License not applicable

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These ground-nesting ants also tend to prefer cooler habitats at middle to high elevations. Workers are generalized scavengers and often tend hemipterans. Species in the subgenera Acanthomyops and Chthonolasius are temporary social parasites on other Lasius species. Species of Acanthomyops were previously considered to represent a different genus, but are now known to be phylogenetically nested within Lasius (see above under “Taxonomic Changes”).

 

Species identification: keys in Wilson (1955a), Wing (1968) ( Acanthomyops ), and Mackay and Mackay (2002). Additional references: Agosti and Bolton (1990b), Cole (1956a, 1958a), Hasegawa (1998), Janda et al. (2004), MacKay (1998), Savolainen (2002), Seifert (1988a, 1992b), Umphrey and Danzmann (1998), Wheeler and Wheeler (1986g).

License not applicable

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Lasius (A) pogonogynus Buren
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Year Collected: 1933
Locality: Red Feather Lakes; Colo, Colorado, United States
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

In Great Britain and/or Ireland:
Animal / sequestrates
female of Lasius meridionalis takes over nest of Lasius

Animal / sequestrates
female of Lasius sabularum takes over nest of Lasius

Animal / sequestrates
queen (newly mated) of Lasius umbratus takes over nest of Lasius

Animal / predator
adult of Solenopsis fugax is predator of brood of Lasius
Other: major host/prey

Animal / guest
larva of Xanthogramma is a guest in nest of Lasius

Animal / guest
larva of Xanthogramma citrofasciatum is a guest in nest of Lasius

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records: 2371
Specimens with Sequences: 2253
Specimens with Barcodes: 2223
Species: 58
Species With Barcodes: 56
Public Records: 321
Public Species: 37
Public BINs: 21
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Lasius cf. hayashi MMANTa40

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTATTTTTTCTCTTCATATTGCTGGGATATCTTCTATTCTAGGAGCTATCAACTTTATTTCAACTATTATAAATATACACCATAAAAATTTTTCTATTGATAAAATTCCCTTACTTGTATGGTCAATTTTAATCACTGCAATTTTATTACTATTATCCCTTCCAGTTCTTGCGGGA---GCTATTACTATACTTCTAACTGACCGTAACCTTAATACTTCATTTTTTGACCCCTCTGGCGGGGGAGATCCTATTTTATATCAACATCTCTTCTGATTTTTTGGACACCCTGAAGTTTATATTTTAATTCTCCCTGGATTTGGACTAATTTCTCATATTATTATAAATGAAAGAGGAAAAAAA---GAAACATTTGGATCTTTAGGAATAATTTATGCTTTAATAGCAATTGGATTTTTAGGATTTGTTGTATGAGCTCACCATATATTTACTATTGGTTTAGATGTTGATACTCGAGCATATTTCACCTCTGCAACTATAATTATTGCTATTCCAACTGGAATCAAAATTTTTAGATGAATTACT---ACTCTCCATGGTACA---AAAATCAATAATAATTCTTCCTTATGATGAGCAATAGGATTTATCTTCTTATTCACTATAGGAGGTTTAACAGGAGTAATACTTTCAAATTCATCAATTGATATTATTCTCCATGACACTTATTACGTAGTAGCTCATTTCCATTATGTA---TTATCAATAGGAGCAGTATTTGCTATTATTGCCAGATTTATTCACTGATTTCCCTTAATAACTGGTTTCTCTTTAAATAATTTTTTCTTAAATATTCAATTTATTTGTATATTCTTTGGAGTCAATTTAACATTTTTTCCTCAACATTTTTTAGGTTTAAGAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lasius cf. hayashi MMANTa40

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lasius Male sp. 01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lasius sp. 04

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lasius sp. 03

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lasius sp. 01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lasius sp. 02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lasius

Lasius is a genus of formicine ants.[2] The type species for this genus is the black garden ant, Lasius niger. Other major members, which live in drier heathland, are the cornfield ant, L. neoniger, and L. alienus

Other species include the temporary social parasites of the L. mixtus group and the hyper-social parasite Lasius fuliginosus.

Lasius flavus is also a commonly seen species, building grassy hillocks in undisturbed pasture. In the Alps, these mounds - always aligned east to catch the first rays of the rising sun - have been traditionally used by goatherds as natural compasses.

The genus was renamed by Horace St. John Kelly Donisthorpe, the eccentric British myrmecologist and coleopterist, after himself Donisthorpea.

Moisture ants[edit]

Many Lasius species, known collectively as "moisture ants" in the United States, make their nests in and around moist rotting wood as well as under rocks.[3][4] They can infest buildings, particularly foundation forms in contact with soil, becoming a minor nuisance.[5][3] They are not considered a structural threat because they only make their galleries in wood that is already decayed.[5] Some species build "cartonlike" nests in moist locations made of decayed wood fragments cemented together with honeydew and the ant's mandibular gland secretions.[4] Workers are monomorphic, 2 to 3 mm long, yellow to dark brown.[3] They are secretive, and forage mostly at night for honeydew and other sweet substances, and may also prey on small insects.[3] Winged reproductive males and females swarm in late summer and fall, which is when building infestations may be noticed.[3] They are distinguished from carpenter ants (Camponotus), another structure-infesting species, by being much smaller, and having a notch in the dorsal thorax (top of the center body division), where carpenter ants have a rounded thorax.[5][3] Widespread moisture ant species include L. alieni and L. neoniger, as well as some Acanthomyops species.[4]

Species[edit]

Lasius niger, queen, workers, and eggs
Cornfield ant, Lasius alienus
Lasius flavus

References[edit]

  1. ^ Bolton, B. (2014). "Lasius". An online catalog of the ants of the world. Retrieved 17 July 2014. 
  2. ^ "Genus: Lasius". AntWeb. Retrieved 02-05-12. 
  3. ^ a b c d e f Klotz, John H. (2010). Urban Pest Management of Ants in California. UCANR Publications, Division of Agriculture and Natural Resources, University of California. pp. 54–55. ISBN 1601076649. 
  4. ^ a b c Klotz, John H. (2008). Urban Ants of North America and Europe: Identification, Biology, and Management. Cornell University Press. pp. 39–44. ISBN 0801474736. 
  5. ^ a b c Antonelli, Art (2007). "Extension Bulletin 1382: Moisture Ants". WSU Extension. Washington State University. Retrieved March 4, 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!