Ecology

Habitat

Depth range based on 203 specimens in 25 taxa.
Water temperature and chemistry ranges based on 102 samples.

Environmental ranges
  Depth range (m): 0 - 4755
  Temperature range (°C): -1.810 - 21.625
  Nitrate (umol/L): 1.146 - 41.121
  Salinity (PPS): 27.165 - 40.679
  Oxygen (ml/l): 1.615 - 7.930
  Phosphate (umol/l): 0.057 - 2.814
  Silicate (umol/l): 2.349 - 160.441

Graphical representation

Depth range (m): 0 - 4755

Temperature range (°C): -1.810 - 21.625

Nitrate (umol/L): 1.146 - 41.121

Salinity (PPS): 27.165 - 40.679

Oxygen (ml/l): 1.615 - 7.930

Phosphate (umol/l): 0.057 - 2.814

Silicate (umol/l): 2.349 - 160.441
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records: 41
Specimens with Sequences: 43
Specimens with Barcodes: 41
Species: 9
Species With Barcodes: 9
Public Records: 27
Public Species: 8
Public BINs: 9
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Eunoe nodosa CMC01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

NNNNCCTTATATTTTATTTTTGGTACTTGATCAGGTCTTCTAGGTACTTCCATAAGGCTCCTGATTCGTGCTGAACTTGGGCAACCTGGATCCCTATTAGGCAGAGATCAATTATACAACACTATTGTTACTGCTCACGCTTTCTTAATAATTTTTTTTCTTGTTATACCAGTCCTAGTTGGAGGATTTGGTAACTGGTTAATCCCACTAATACTTGGAGCTCCTGATATGGCCTTTCCACGATTAAATAATATAAGATTTTGATTATTACCCCCTTCTCTAATTCTTTTACTATCTTCGAGAGCAGTCGAAAAAGGAGTGGGAACAGGTTGAACAGTATACCCTCCTCTCGCTTCTAATATTGCTCACGCTGGCCCTTCTGTAGATCTAGCTATCTTTTCTCTCCACATTGCAGGAGTTTCTTCTATTCTTGGAGCTCTTAATTTTATTACAACTGTTGTTAATATACGATATAAAGGCCTGCGTCTTGAACGTGTTCCACTTTTTGTGTGAGCCGCTAAAATTACAGCTATTCTACTACTCCTATCTCTACCTGTATTAGCAGGTGCTATTACTATACTCTTAACCGATCGAAACCTTAATACAGCTTTTTTTGATCCTGCGGGAGGAGGAGATCCTGTTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eunoe nodosa CMC01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Eunoe nodosa CMC02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCACCTTATATTTTATTTTTGGTACTTGATCAGGTCTTCTAGGTACTTCCATAAGGCTCCTGATTCGTGCTGAACTTGGACAACCTGGATCCCTATTAGGCAGAGATCAATTATATAACACTATCGTTACCGCTCACGCTTTCTTAATAATTTTTTTTCTTGTTATACCAGTCCTAGTAGGAGGATTTGGTAACTGGTTAATCCCACTAATACTTGGAGCTCCTGATATGGCCTTTCCACGATTAAATAATATAAGATTTTGATTATTACCTCCTTCTCTAATTCTTTTACTATCTTCGAGAGCAGTCGAAAAAGGAGTTGGAACAGGTTGAACAGTATACCCTCCTCTCGCTTCTAATATTGCTCACGCTGGCCCTTCTGTTGATCTAGCTATTTTTTCTCTCCATATTGCAGGGGTTTCTTCTATTCTTGGAGCTCTAAATTTTATTACAACTGTCGTTAATATACGATATAAAGGCCTGCGTCTTGAACGTGTCCCACTTTTTGTGTGAGCCGCTAAAATTACAGCTATTCTACTACTCCTATCTCTACCTGTATTAGCAGGTGCTATTACTATACTCTTAACTGATCGAAACCTTAATACAGCTTTTTTTGATCCTGCGGGAGGAGGGGATCCTGTTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eunoe nodosa CMC02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Eunoe oerstedi CMC02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNCTTATATTTTATTTTTGGAACTTGATCAGGTCTTTTAGGAACTTCTATAAGACTTCTTATTCGTGCTGAATTAGGTCAACCCGGATCCTTATTAGGTAGAGATCAATTGTACAACACTATTGTTACAGCTCATGCTTTTTTAATAATTTTTTTCCTTGTTATACCGGTTCTTGTAGGTGGGTTTGGTAATTGATTAATTCCGTTAATACTAGGAGCACCTGATATGGCTTTTCCACGATTAAACAACATAAGATTTTGATTATTACCTCCTTCCTTAATTCTCTTATTATCTTCAAGGGCCGTTGAAAAAGGAGTAGGAACAGGATGAACAGTCTATCCTCCTCTTGCTTCTAATATTGCTCATTCAGGACCTTCAGTTGATTTAGCTATTTTTTCTTTACATATTGCAGGAGTTTCTTCTATTTTAGGAGCTCTAAATTTTATTACTACTGTTATTAATATACGATATAAAGGATTACGACTTGAACGTGTACCGCTTTTTGTGTGAGCTGCTAAAATTACAGCAATTCTATTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACCATACTTTTAACTGATCGTAATCTTAACACCGCTTTCTTTGACCCCGCAGGTGGAGGAGATCCCGTTCTTTACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eunoe oerstedi CMC02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Eunoe oerstedi CMC01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCACCTTATATTTTATTTTTGGAACTTGATCAGGTCTTTTAGGAACGTCTATAAGACTTCTTATTCGTGCTGAATTAGGTCAACCCGGATCCTTATTAGGTAGAGACCAATTATATAACACTATTGTTACTGCCCATGCTTTTTTAATAATTTTTTTCCTTGTTATACCAGTTCTAGTAGGTGGGTTTGGTAATTGATTAATTCCCTTAATACTAGGAGCACCTGATATGGCTTTCCCACGATTAAATAACATAAGATTTTGGTTACTCCCCCCTTCCTTAATTCTCTTATTATCTTCAAGAGCTGTTGAAAAAGGAGTAGGAACAGGATGAACAGTATACCCTCCTCTTGCTTCTAATATTGCTCATTCAGGGCCTTCAGTTGATTTAGCTATTTTTTCTTTACATATTGCAGGAGTTTCTTCTATTTTAGGAGCTCTAAATTTTATTACTACTGTTATTAATATACGATATAAAGGATTACGACTTGAACGTGTCCCACTTTTTGTATGAGCTGCTAAAATTACAGCAATCCTATTATTATTATCCCTACCTGTATTAGCAGGTGCTATTACTATACTTTTAACTGACCGTAATCTTAACACCGCTTTCTTTGATCCTGCAGGAGGAGGAGATCCAGTTCTTTACCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eunoe oerstedi CMC01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!