Articles on this page are available in 1 other language: German (1) (learn more)

Overview

Comprehensive Description

41. Formica HNS Dalmatica.

Formica HNS Dalmatica, Nyl. Addit. Alter. Adno. Mon. Form. Bor. 37.

Hab. Dalmatia.

  • Smith, F. (1858): Catalogue of the hymenopterous insects in the collection of the British Museum. Part VI. Formicidae. London, British Museum: 12-12, URL:http://antbase.org/ants/publications/8127/8127.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

1 st, Formica HNS ,

without " sting, the antennae inserted near the forehead, and with triangular jaws; abdominal pedicle of only one knot or scale.

  • Jerdon, T. C. (1851): A catalogue of the species of ants found in southern India. Madras Journal of Literature and Science 17, 103-127: 103-103, URL:http://antbase.org/ants/publications/4764/4764.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Gen. Formica HNS .

This genus comprises two distinct forms, the one with spines on the thorax, the other unarmed, which certainly ought to form two genera, inasmuch as this distinction is made to separate Atta HNS from Ocodoma HNS .

1 st, without spines on the thorax.

  • Jerdon, T. C. (1851): A catalogue of the species of ants found in southern India. Madras Journal of Literature and Science 17, 103-127: 119-119, URL:http://antbase.org/ants/publications/4764/4764.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Squamula erecta thoraci abdomi nique interjecta.

Aculeus Feminis [and] Neutris reconditus.

Alae Maribus [and] Feminis; sed Neutris nullae.

  • Linnaeus, C. (1758): Systema naturae. Regnum Animale. 10 th ed. Lipsiae, W. Engelmann: 579-579, URL:http://hdl.handle.net/10199/15420
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genus 1. FORMICA HNS .

Formica HNS , pt., Linn. Faun. Suec. 426 (1761); Syst. Nat. i. 962 (1766).

Lasius HNS , pt., Fabr. Syst. Piez. 415 (1804).

Cataglyphis HNS , Foerst. Hym. Stud. Form. 485 (1850).

Tapinoma HNS , pt., Schenck, Besch. Nass. Ameis. 129 (1852).

Monocombus HNS ,.Mayr. 110 (1855).

The maxillary palpi 6-jointed; the labial palpi 4-jointed. Ocelli 3, placed in a triangle on the vertex*. Males and females winged, constantly so in the former sex, temporarily so in the latter. The superior wings with one marginal and two submarginal cells; one division having also a complete discoidal cell, another in which it is obsolete; the petiole of the abdomen furnished with a single vertical scale. None of the individuals furnished with a sting. The pupae enclosed in silken cocoons.

* In a few species these are obliterated, or scarcely discernible, as in the small workers of F. flava and F. nigra , &c.

  • Smith, F. (1858): Catalogue of the hymenopterous insects in the collection of the British Museum. Part VI. Formicidae. London, British Museum: 1-1, URL:http://antbase.org/ants/publications/8127/8127.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

1. FORMICA HNS .

Formica HNS , pt, Linn. Faun. Suec. 426,1761. Lasius HNS , pt, Fab. Syst. Piez. 415, 1804.

  • Smith, F. (1851): List of the specimens of British animals in the collection of the British Museum. Part VI. - Hymenoptera Aculeata. London, British Museum: 1-1, URL:http://antbase.org/ants/publications/8200/8200.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

1. FORMICA HNS Linn.

Latr. Fabr. Zett. Lepelet. de S: t Farg. Dahlbom. Losana.

Corpus majoris, mediae vel parvae staturae. Lingua brevis rotundata. Palpi maxillares 6 - articulati, labiales 4 - articulati dimidia longitudiue priorum breviores. Antennae fractae valde vibrabiles; scopus longitudine dimidiae vel saltem plus quam tertae partis tonus antennae.

Operaria magnitudine est maris vel parum major aut minor, formatione capitis ejusque partium sicut feminae, praeter quod in nonnullis speciebus nulla habeat stemmata. Thorax anterius rotundatus capite semper gracilior, lateribus compressis, dorso in aliis aequali, in aliis medio immerso locoque scutelli elevatiusculo. Abdomen ovato-rotundatum capite latius, longitudiue thoracis *). Pedes tarsis longioribus gracilioribus quam in femina.

Femina saepissime major est quam operaria et mas. Mandibulae latae robustae, apice denticulatae. Antennae 12 - articutatae

(praeter radiculam), capite duplo longiores, flagello filiformi versus apicem perparum incrassato. Ocelli semper adsunt. Thorax compresso-subovatus duplo fere altior et latior quam operaria, scutello ejusdem altitudinis ac dorsum thoracis. Alae amplae, anteriores corpore saepissime paullo longiores, posteriores abdomen excedentes; nervi conspicui, area radialis anguste triangularis clausa, areae cubitales binae angulis acutissimis invicem conterminae, et in plurimis nostris adhuc area discoidalis trapezoidea, basi areae cubitalis primae aduexa, obveniunt. Pedes tibiis anticis intus versus apices saepissime parce spinulosis vel setulosis. Abdomen 5 - annulatum capite latius et thorace nonnihil longius oblongo-rotundatum depressiusculum vel subglobosum et tum brevius. Genitalia inclusa intra ultimum segmentum.

Mas plerumque femina multo minor, sed interdum ejusdem magnitudinis. Caput multo minus quam in femina, minusque adhuc quam in operaria, mandibulis fere triplo saepissime angustioribus quam in iis oculisque magis prominulis. Antennae 13 - articulatae graciliores quam in femina, flagello aequali. Thorax gibbosus. Alae ut in femina, corporis circiter longitudine. Abdomen 6 - annulatum latitudine thoracis, longitudine thoracis capitisque, subconicum supra deplanatus, ano aliquantum angustato et deflexo, genitalibus ad partem exsertis valvulaque ventrali subtus suffultis. Partes genitalium procedentes varie formatae praecipue sunt: squamutae laterales, penicilli dorsales pilosuli membranula versus basin conjuncti, vaginae externae et internae atque inter has ambas utrinque partes vaginantes aliae breviores unco in apice: saepe munitae (vaginae intermediae). Tarsi graciliores quam in operariis, pulvillis et unguiculis magnis.

Subdivis. 1. [[ worker ]] et [[ queen ]] corpore in hoc genere maximo, [[ worker ]] stemmatibus nullis, thoracis lateribus valde compressis, dorso aequali, [[ queen ]] [[ male ]] planiusculo. Alae area discoidali nulla. [[ queen ]] abdomine oblongo-rotundato. [[ male ]] genitalibus parvis, vaginis angustis, externis rectis.

  • Nylander, W. (1846): Adnotationes in monographiam formicarum borealium Europae. Acta Societatis Scientiarum Fennicae 2, 875-944: 892-894, URL:http://antbase.org/ants/publications/4277/4277.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genus Formica HNS Linne, 1758

Formica HNS Linne, 1758: 579.

Type-species: Formica rufa Linne HNS , 1758 (Yarrow, 1954).

Antennae 12 segmented in worker and female, 13 segmented in male; antennal insertions contiguous with clypeal border. Funiculus segments 2 to 5 longer than 6 to 10. Maxillary palps 6 segmented, occasionally 5; labial palps 4 segmented. Ocelli distinct in all castes; frontal ridges diverging posteriorly; frontal triangle always very distinctly defined. Propodeal spiracle elliptical placed at some distance from propodeal border. Wings with cubital and one discoidal cell. Male external genitalia large and conspicuous. The species of this genus are relatively robust and active.

Holarctic genus with over 150 species. There are at least 20 species known to occur in Fennoscandia; in some groups, notably F. rufa HNS and its allies, species distinctions are not always clearcut necessitating the comparison of a number of specimens preferably with males and females as well as workers.

Keys to species of Formica HNS

Workers

1 Bicoloured species: alitrunk red with varying amounts of dark brown to blackish patches........................................................................................ 2

Body colour evenly greyish or brownish black ........................................... 18

2(1) Anterior margin of clypeus emarginate or with distinct median notch (Fig. 222) ........................................................................... 56. sanguinea Latreille HNS

Anterior margin of clypeus broadly rounded and entire................................ 3

3 (2) Head flattened posteriorly, with deeply concave occipital border.................. 4

Head evenly rounded posteriorly, occipital margin straight, convex or very weakly concave......................................................................................... 8

4 (3) Eyes with distinct microscopic hairs; maxillary palps longer than half head length (Figs. 201,212) ................................................... 50. exsecta Nylander HNS

Eyes bare; maxillary palps half head length or shorter ................................. 5

5(4) Occipital corners smoothly rounded; posterior emargination shallow, head not longer than maximum width across eyes; maxillary palps 6 segmented, as long as half head length (Fig. 213) ...................................... 54. suecica Adlerz HNS

Occipital corners sharp; back of head deeply emarginate; maxillary palps often 5 segmented, shorter than half head length; head longer than broad 6

6 (5) Dorsal hairs on gaster few but present on all tergites; middle of clypeus as well as its anterior border with projecting hairs (Figs. 204,205) 52. forsslundi Lohmander HNS

Dorsal hairs on gaster restricted to posterior margin of third tergite to apex; clypeal hairs restricted to anterior border (Fig. 207) ............................ 7

7 (6) Gaster moderately shining, with dilute sculpture and pubescent hairs shorter than their interspaces. Clypeus transversely impressed below midline (Figs. 206,215) ................................................................. 53. pressilabris Nylander HNS

Basal tergite of gaster with upper surface sculptured and dull; pubescent hairs slightly longer than their interspaces. Clypeus with or without shallow impression below midline (Fig. 216)...................................... 51. foreli Emery HNS

8(3) Frontal triangle dull; terminal segment of maxillary palp as long as fifth segment.................................................................................................... 9

Frontal triangle reflecting light; terminal segment of maxillary palp shorter than fifth segment.................................................................................... 12

9 (8) Head and frontal triangle coarsely sculptured, opaque black. Head as broad as long; antennal scape short, not over-reaching occipital margin by more than 1/4 its length (Fig. 219)............................................ 55. uralensis Ruzsky HNS

At least genal margins and clypeus reddish, sculpture weaker but pubescense strongly developed and moderately thick especially on gaster. Head distinctly longer than broad; antennal scape slender, over-reaching occipital margin by 1/3 its length or more ............................................................................... 10

10 (9) Whole body including gula and posterior margin of head with numerous projecting hairs (Figs. 162,188)............................................ 47. cinerea Mayr HNS

Gula and posterior margin ofhead entirely without hairs............................ II

11 (10) Dorsum of promesonotum and upper margin of petiole scale with projecting hairs (Fig. 197)........................................................... 49. rufibarbis Fabricius HNS

Promesonotum and scale without projecting hairs, occasionally one or two short hairs present on promesonotum (Fig. 193)........... 48. cunicularia Latreille HNS

12 (8) Antennae long with scapes longer than head width; second and third funiculus segments in larger workers twice as long as broad (Fig. 225) 57. truncorum Fabricius HNS

Antennal scape shorter than head width; funiculus segments always less than twice as long as broad .............................................................................. 13

13 (12) Gaster thickly pubescent and dull; frons closely sculptured and dull: dark patch on promesonotum normally clearly defined and opaque.................... 14

Gaster and frons moderately shining; dark patch on promesonotum very variable, not normally clearly defined and sometimes absent ...................... 15

14 (13) Head and body profusely hairy with longest hairs on alitrunk x 0.1 or more head width. Antennal scapes usually with two or three short projecting subde- cumbent hairs (Fig. 266).................................................. 63. nigricans Emery HNS

Pilosity variable, alitrunk hairs usually less than x 0.1 head width. Antennal scapes with adpressed pubescence only (Figs. 256, 261) .... 62. pratensis Retzius HNS

Figs. 159-162. Head of Formica-workers in dorsal view. - 159: fusca (L.) HNS ; 160: rufibarbis Fabr HNS .; 161: cunicularia Latr HNS .; 162: cinerea Mayr HNS . Scale: 1 mm.

15 (13) Eyes, gula, alitrunk and posterior margin of head conspicuously hairy, with hairs extending forward laterally as far as eyes (Figs. 249. 254) 61. lugubris Zetterstedt HNS

Eyes with very short hairs or bare. Fringe of hairs at back of head when present not extending forward beyond occipital corners............................. 16

16(15) First tergite of gaster evenly and closely set with micropunctures; eyes always with distinct short hairs; frons closely sculptured and rather dull; extensor surface of hind femora and tibiae always with some projecting hairs; posterior ofhead with projecting hairs, sometimes very few or absent (Figs. 242, 247) 60. aquilonia HNS YarrowFirst tergite of gaster with punctures widely spaced on upper medial area; eyes bare or with very few microscopic hairs; frons moderately shining with shallow sculpture and easily seen scattered coarse punctures. Back of head without projecting hairs ........................................................................... 17

17 (16) Gula, dorsum of head and alitrunk with conspicuous projecting hairs; occasional or few projecting hairs normally present on extensor surface of hind femora and tibiae. Mesopleurae from above with evenly distributed long hairs (Fig. 229)........................................................................ 58. rufa Linne HNS

Gula bare or with one or two weak hairs, dorsum of head and alitrunk with occasional short hairs. Hind femora and tibiae normally bare. From above projecting hairs on mesopleurae restricted to a few only at posterior end (Fig. 236)...................................................................... 59. polyctena Forster HNS

18(1) Back and underside of head with copious erect hairs (Fig. 188) 47. cinerea Mayr HNS

Back of head bare ................................................................................... 19

19(18) Dorsum of promesonotum with erect hairs................................................ 20

Dorsum of promesonotum bare or with occasional one or two hairs only .... 21 20(19) Whole body brilliantly shining; premesonotal hairs pointed, long and curving forward; one or two gula hairs often present (Fig. 184) 46. transkaucasica Nasonov HNS Body with subdued shine; premesonotal bristles short and blunt; gula hairs never present (Fig. 182)................................................... 45. lemani Bondroit HNS

21 (19) Gaster shining, with very dilute pubescence and absence of sculpture medially; petiole scale emarginate dorsally .......................... 44. gagatoides Ruzsky HNS

Gaster with close pubescence and microsculpture; petiole scale with rounded or flat dorsal crest.................................................................. 43. fusca Linne HNS

Females

1 Anterior margin of clypeus impressed or notched ......... 56. sanguinea Latreille HNS

Anterior margin of clypeus entire, broadly convex....................................... 2

2 (I) Occipital margin of head deeply excised or broadly emarginate .................... 3

Occipital margin of head convex................................................................. 7

3 (2) Eyes with copious hairs; size larger, length: 7.5-9.0 mm ... 50. exsecta Nylander HNS

Eyes bare; size smaller, length: 5.5-7.2 mm.................................................. 4

4 (3) Occipital corners smoothly rounded, emargination of head shallow; petiole scale with angular lobes; maxillary palps 6 segmented ......... 54. suecica Adlerz HNS

Occipital corners sharp, enclosing deep emargination: petiole scale with rounded lobes; maxillary palps short, normally 5 segmented......................... 5

5 (4) Erect hairs present on dorsum of second gaster tergite to apex; middle of clypeus with long hairs........................................... 52. forsslundi Lohmander HNS

Erect hairs on dorsum of gaster restricted to posterior border of third tergite to apex; clypeal hairs restricted to anterior border only...................... 6

6 (5) Body uniformly shining dark brown.......................... 53. pressilabris Nylander HNS

Gaster somewhat matt appearance, propodeum and petiole yellowish red 51. foreli Emery HNS

7 (2) Body colour uniformly brownish black or black........................................... 8

Body bicoloured with portions of alitrunk at least distinctly reddish ............ 12

8 (7) Back of head and gula with copious erect hairs (Fig. 190) ...... 47. cinerea Mayr HNS

Back ofhead always bare........................................................................... 9

9 (8) Underside of mid femora bare; in dorsal view hairs on pronotum restricted to anterior portion only............................................................................ 10

Underside of mid femora with several long hairs; erect hairs on pronotum extend round the sides to the tegulae......................................................... 11

10 (9) Gaster and scutellum brilliant; middle of gaster dorsum impunctate, pubes- cence very sparse and dilute; petiole scale broadly heart-shaped; gula hairs occasionally present (Fig. 181)..................................... 44. gagatoides Ruzsky HNS

Gaster and scutellum with subdued shine, with distinct microsculpture an pubescence; petiole scale normally with dorsal crest flat or convex; gula hairs never present (Fig. 178).................................................. 43. fusca Linne HNS

11 (9) Whole body shining; pubescence on gaster long but sparse; 2 or 3 gula hairs

normally present (Fig. 187)................................... 46. transkaucasica Nasonov HNS Gaster dull with close pubescence and distinct microsculpture; underside of head always bare (Fig. 183).............................................. 45. lemani Bondroit HNS

12(7) Frontal triangle densely sculptured or dull. Eyes completely hairless. Terminal segment of maxillary palp as long as fifth.......................................... 13

Frontal triangle reflecting light. Eyes with conspicuous hairs or with occasional microscopic hairs. Terminal segment of maxillary palp shorter than preceding segments ................................................................................. 16

13 (12) Whole body including gula and posterior margin of head with, profuse hairs; body colour mainly brownish black, but occasionally genae and mesopleural articulations reddish (Fig. 190)............................................. 47. cinerea Mayr HNS

Hairs entirely absent on posterior margin of head ...................................... 14

14 (13) Head entirely black, coarsely sculptured; antennal scape short and thick; femora black; underside of head usually with a few coarse hairs 55. uralensis Ruzsky HNS

Genae and clypeus distinctly reddish; antennal scapes slender: femora yellowish red; underside of head always bare ...................................................... 15

15 (14) Propodeum with a few erect hairs; mesoscutum in part reddish (Fig. 199) 49. rufibarbis Fabricius HNS

Propodeum without erect hairs; mesoscutum normally entirely dark (Fig. 195) .......................................................................... 48. cunicularia Latreille HNS

16(12) Gaster and whole of scutum matt with more or less dense pubescence ........ 17

Gaster and scutellum distinctly shining; pubescence dilute, not obscuring cuticular shine......................................................................................... 19

17 (16) Second funiculus segment twice as long as broad. Whole body including meso-

notum with large shallow punctures. Head normally with red colour predominating(Fig. 226) ............................................... 57. truncorum Fabricius HNS

Second funiculus segment always less than twice as long as broad. Larger punctures deep and normally concealed by pubescence............................. 18

18 (17) Whole body including propodeum, scale and basal face of gaster with conspi- cuous long bent hairs. Antennal scape often with two or three projecting

hairs (Figs. 263, 264)........................................................ 63. nigricans Emery HNS

Projecting hairs on posterior margin of head and basal face of gaster normally short, absent on dorsum of propodeum and scale. Scapes without projecting hairs (Figs. 258,259) ................................................. 62. pratensis Retzius HNS

19 (16) Back of head, basal face of gaster scale and propodeum with long hairs (Figs.

251,252).................................................................... 61. lugubris Zetterstedt HNS

Dorsum of scale and propodeum without hairs, back of head and basal face of gaster either bare or with short sparse hairs............................................ 20

20 (19) Gaster including medial dorsal area of first tergite very finely and closely set with micropunctures. Eyes with distinct short erect hairs (Figs. 174, 244, 245) ............................................................................. 60. aquilonia Yarrow HNS

Micropunctures on gaster sparse and widely set, larger punctures well spaced and clearly visible. Eyes with a few microscopic hairs or bare (Figs. 171,172,232,239).................................................................................... 21

21 (20) Middle of scutellum normally brilliant, without punctures or striae. 58. rufa Linne HNS

Middle of scutellum with longitudinal striae and punctures rather dull 59. polyctena Forster HNS

Males

1 Back ofhead broadly excavate with pronounced occipital angles ................. 2

Back of head convex ................................................................................. 6

2(1) Occipital margins and eyes conspicuously hairy (Fig. 208) 50. exsecta Nylander HNS

Occipital margins and eyes bare or with very sparse short hairs..................... 3

3 (2) Mesonotum with scattered hairs; maxillary palps 6 segmented; occipital corners smoothly rounded (Fig. 209)....................................... 54. suecica Adlerz HNS

Mesonotum bare; maxillary palps short, normally 5 segmented; occipital corners sharp ............................................................................................ 4

4 (3) Outstanding hairs on dorsum of gaster present on second tergite to apex 52. forsslundi Lohmander HNS

Outstanding hairs on gaster restricted to fifth tergite to apex......................... 5

5 (4) Body shining; pubescent hairs on gaster shorter than interspace; eyes with 1 or 2 microscopic hairs at most .................................. 53. pressilabris Nylander HNS

Body somewhat dull; pubescent hairs on gaster longer than interspaces; eyes with scattered microscopic hairs.................................... 51. foreli Emery HNS

6 (1) Front border of clypeus emarginate or notched in middle (Fig. 221) 56. sanguinea Latreille HNS

Front border of clypeus not impressed, with straight or convex front border ...................................................................................................... 7

7 (6) Eyes with conspicuous hairs ....................................................................... 8

Eyes bare................................................................................................ 14

8 (7) Whole body thickly haired, in side view suberect hairs on dorsum of gaster numerous and uninterrupted from base to apex. Frontal triangle without punctures or coarse sculpture. Legs and external genitalia mainly yellow. Antennae long and slender, second and third funiculus segment more than x 2.5 as long as broad (Fig. 227) .................................... 57. truncorum Fabricius HNS

In side view hairs on dorsum of gaster sparse and not appearing as an uninterrupted fringe. Frontal triangle shining but normally micropunctures and/ or some pubescence present. Genitalia and legs with at least femora partly infuscated. Funiculus segments less than x 2.5 as long as broad..................... 9

Figs. 163-168. Petiole scale of Formica-mates in posterior view. - 163: transkaucasica Nasonov HNS ; 164: gagatoides Ruzsky HNS ; 165: fusca (L.) HNS ; 166: lemani Bondr HNS ., 167: cunicularia Latr HNS .; 168: rufibarbis Fabr HNS . Scale: 1 mm.

9 (8) Scutellum and gaster pubescent and dull (eyes and genae always with profuse hairs) ...................................................................................................... 10

Scutellum and gaster at least moderately shining........................................ 11

10 (9) Tibial hairs numerous, with occasional long erect hairs on hind tibiae at least x 0.5 maximum tibial width ............................................. 63. nigricans Emery HNS

Tibial hairs short often sparse, none exceeding x 0.3 hind tibial width (Fig. 257) .............................................................................. 62. pratensis Retzius HNS

11 (9) Genal hairs profuse. Tibial hairs long and profuse (Figs. 250,253) 61. lugubris Zetterstedt HNS

Genal margins below eyes either with a few projecting hairs or none. Tibial hairs short and sparse or absent ................................................................ 12

12 (11) Frons and gaster very finely punctured. Fringe of short hairs always present on upper surface of hind femora. In normal populations projecting hairs are present on the genae below eyes (Fig. 246) ..................... 60. aquilonia Yarrow HNS

Frons and gaster widely and coarsely punctured. Upper surface of hind femora with occasional hairs or none ........................................................ 13

13 (12) Metanotum bare or with sparse hairs. Longer hairs on mesonotum sparse. Genae never with projecting hairs below eyes (Fig. 237) 59. polyctena Forster HNS Metanotum with long hairs which are also numerous over mesonotum. Genal projecting hairs occasionally present in some populations, normally absent (Fig. 230)................................................................................ 58. rufa Linne HNS

14(7) Scutellum dull or opaque ......................................................................... 15

Scutellum moderately shining or brilliant .................................................. 18

15 (14) Antennal scapes thick - width equal to more than half narrowest eye width; head broad and not conspicuously narrowed anteriorly; femora and whole body opaque black, coarsely sculptured, petiole scale broadly convex (Fig. 220) .............................................................................. 55. uralensis Ruzsky HNS

Antennal scapes slender - maximum width less than x 0.3 minimum eye width; head narrowing conspicuously towards clypeal border; sculpture fine but obscured by more or less thick pubescence on dorsal surfaces; legs yellowish or yellowish red with only femora sometimes infuscate, petiole scale emarginate..................................................................................................... 16

16 (15) Underside ofhead with erect hairs (Fig. 192) ........................ 47. cinerea Mayr HNS

Underside of head always bare ................................................................. 17

17 (16) Femora dark at least in part. Dorsal border of petiole scale sharply angulate at sides (Fig. 168) ....................................................... 49. rufibarbis Fabricius HNS

Figs. 169, 170. Electroscan micrographs of Formica HNS -eyes. - 169: worker of rufa L. HNS 170: worker of pratensis Retzius HNS . Scale: 100 u.

Figs. 171-175. Electroscan micrographs of dorsum of first gaster tergite in Formicaqueens. - 171: rufa L. HNS , 172: polyctena Forster HNS ; 173: lugubris Zett HNS ., 174: aquilonia Yarrow HNS ; 175: pratensis Retzius HNS . Scale: 100 u.

Femora unicolorous with tibiae reddish or pale reddish yellow, sides of petiole scale rounded................................................. 48. cunicularia Latreille HNS

18 (14) Petiole scale with very short fine hairs only; normally with rounded or flat dorsal border (Fig. 165).......................................................... 43, fusca Linne HNS

Petiole scale with long hairs; dorsal border more or less deeply emarginate (Figs. 163, 164,166).................................................................................. 19

19 (18) Underside of mid and hind femora bare; erect hairs on promesonotum sparse, short and weak ................................................ 44. gagatoides Ruzsky HNS

Underside of mid femora with one or more scattered hairs, semi-erect hairs on promesonotum numerous and strong ........................................... 20

20 (19) Gaster brilliant almost without sculpture medially, with long fine scattered pubescence; underside of head normally with one or two long hairs; frontal triangle shining.................................................... 46. transkaucasica Nasonov HNS

Gaster moderately shining with short close pubescence and distinct microsculpture. Underside of head never with hairs; frontal triangle dull 45. lemani Bondroit HNS

  • Collingwood, C. A. (1979): The Formicidae (Hymenoptera) of Fennoscandia and Denmark. Fauna Entomologica Scandinavica 8, 1-174: 111-120, URL:http://antbase.org/ants/publications/6175/6175.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

71. Formica HNS Bacchus. B.M.

Worker. Length 4 1/2 lines.-Black: the flagellum, thorax, legs and scale of the peduncle rufo-testaceous; the tibiae and basal joint of the tarsi more or less dusky; head large and cordate; eyes ovate, placed above the middle at the sides of the head; the head opake; the clypeus subcarinate in the middle and shining, as well as the mandibles, the latter armed with six stout teeth; the extreme base of the scape pale testaceous. Thorax much narrower than the head, rounded anteriorly and compressed behind. Abdomen: the scale incrassate, narrowed to a thin edge at its upper margin, which is rounded; the scale is narrow, rounded in front and straight behind; the abdomen oblong-ovate; the head, thorax and abdomen have a few scattered, long, erect pale hairs.

Hab. Ceylon.

  • Smith, F. (1858): Catalogue of the hymenopterous insects in the collection of the British Museum. Part VI. Formicidae. London, British Museum: 21-21, URL:http://antbase.org/ants/publications/8127/8127.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genus Formica Linnaeus HNS

In California the members of this genus are most prevalent in montane habitats, although a few species occur in drier, low elevation sites. Formica HNS species are ground-nesting ants with generalist foraging habits. Francoeur’s (1973) authoritative revision of the Formica fusca-group HNS allows the species in that group to be relatively easily identified. Taxonomic difficulties still plague the Formica rufa-group HNS , which contains most of the remaining species in California.

Species identification: keys in Francoeur (1973), Wheeler and Wheeler (1986g), Snelling and Buren (1985) and Mackay and Mackay (2002). Additional references: Agosti (1994b), Agosti and Bolton (1990b), Buren (1968a), Cole (1956d, 1956f, 1956g), Creighton(1940a, 1950a), Dlussky (1967), Francoeur and Snelling (1979), Gösswald (1989, 1990), Savolainen (1998), Smith (1979), Trager et al. (2005), Wilson and Brown (1955).

  • Ward, P. S. (2005): A synoptic review of the ants of California (Hymenoptera: Formicidae). Zootaxa 936, 1-68: 29-29, URL:http://antbase.org/ants/publications/21008/21008.pdf
Public Domain

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Formica HNS sp. CA-01

In the F microgyna HNS subgroup, within the F rufa-group HNS .

  • Ward, P. S. (2005): A synoptic review of the ants of California (Hymenoptera: Formicidae). Zootaxa 936, 1-68: null, URL:http://antbase.org/ants/publications/21008/21008.pdf
Public Domain

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

In the F microgyna subgroup, within the F rufa-group .

License not applicable

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In California the members of this genus are most prevalent in montane habitats, although a few species occur in drier, low elevation sites. Formica species are ground-nesting ants with generalist foraging habits. Francoeur’s (1973) authoritative revision of the Formica fusca-group allows the species in that group to be relatively easily identified. Taxonomic difficulties still plague the Formica rufa-group , which contains most of the remaining species in California.

 

Species identification: keys in Francoeur (1973), Wheeler and Wheeler (1986g), Snelling and Buren (1985) and Mackay and Mackay (2002). Additional references: Agosti (1994b), Agosti and Bolton (1990b), Buren (1968a), Cole (1956d, 1956f, 1956g), Creighton(1940a, 1950a), Dlussky (1967), Francoeur and Snelling (1979), Gösswald (1989, 1990), Savolainen (1998), Smith (1979), Trager et al. (2005), Wilson and Brown (1955).

License not applicable

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Latr. Fabr. Zett. Lepelet. de S: t Farg. Dahlbom. Losana.

 

Corpus majoris, mediae vel parvae staturae. Lingua brevis rotundata. Palpi maxillares 6 - articulati, labiales 4 - articulati dimidia longitudiue priorum breviores. Antennae fractae valde vibrabiles; scopus longitudine dimidiae vel saltem plus quam tertae partis tonus antennae.

 

Operaria magnitudine est maris vel parum major aut minor, formatione capitis ejusque partium sicut feminae, praeter quod in nonnullis speciebus nulla habeat stemmata. Thorax anterius rotundatus capite semper gracilior, lateribus compressis, dorso in aliis aequali, in aliis medio immerso locoque scutelli elevatiusculo. Abdomen ovato-rotundatum capite latius, longitudiue thoracis *). Pedes tarsis longioribus gracilioribus quam in femina.

 

Femina saepissime major est quam operaria et mas. Mandibulae latae robustae, apice denticulatae. Antennae 12 - articutatae

 

(praeter radiculam), capite duplo longiores, flagello filiformi versus apicem perparum incrassato. Ocelli semper adsunt. Thorax compresso-subovatus duplo fere altior et latior quam operaria, scutello ejusdem altitudinis ac dorsum thoracis. Alae amplae, anteriores corpore saepissime paullo longiores, posteriores abdomen excedentes; nervi conspicui, area radialis anguste triangularis clausa, areae cubitales binae angulis acutissimis invicem conterminae, et in plurimis nostris adhuc area discoidalis trapezoidea, basi areae cubitalis primae aduexa, obveniunt. Pedes tibiis anticis intus versus apices saepissime parce spinulosis vel setulosis. Abdomen 5 - annulatum capite latius et thorace nonnihil longius oblongo-rotundatum depressiusculum vel subglobosum et tum brevius. Genitalia inclusa intra ultimum segmentum.

 

Mas plerumque femina multo minor, sed interdum ejusdem magnitudinis. Caput multo minus quam in femina, minusque adhuc quam in operaria, mandibulis fere triplo saepissime angustioribus quam in iis oculisque magis prominulis. Antennae 13 - articulatae graciliores quam in femina, flagello aequali. Thorax gibbosus. Alae ut in femina, corporis circiter longitudine. Abdomen 6 - annulatum latitudine thoracis, longitudine thoracis capitisque, subconicum supra deplanatus, ano aliquantum angustato et deflexo, genitalibus ad partem exsertis valvulaque ventrali subtus suffultis. Partes genitalium procedentes varie formatae praecipue sunt: squamutae laterales, penicilli dorsales pilosuli membranula versus basin conjuncti, vaginae externae et internae atque inter has ambas utrinque partes vaginantes aliae breviores unco in apice: saepe munitae (vaginae intermediae). Tarsi graciliores quam in operariis, pulvillis et unguiculis magnis.

 

Subdivis. 1. [[ worker ]] et [[ queen ]] corpore in hoc genere maximo, [[ worker ]] stemmatibus nullis, thoracis lateribus valde compressis, dorso aequali, [[ queen ]] [[ male ]] planiusculo. Alae area discoidali nulla. [[ queen ]] abdomine oblongo-rotundato. [[ male ]] genitalibus parvis, vaginis angustis, externis rectis.

License not applicable

Nylander, W.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This genus comprises two distinct forms, the one with spines on the thorax, the other unarmed, which certainly ought to form two genera, inasmuch as this distinction is made to separate Atta from Ocodoma .

 

1 st, without spines on the thorax.

License not applicable

Jerdon, T. C.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

without " sting, the antennae inserted near the forehead, and with triangular jaws; abdominal pedicle of only one knot or scale.

License not applicable

Jerdon, T. C.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Formica Chilensis , Spin. Faun. Chili, vi. 237. 2 [[worker]].

 

Hab. Chili.

License not applicable

Smith, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Worker. Length 4 1/2 lines.-Black: the flagellum, thorax, legs and scale of the peduncle rufo-testaceous; the tibiae and basal joint of the tarsi more or less dusky; head large and cordate; eyes ovate, placed above the middle at the sides of the head; the head opake; the clypeus subcarinate in the middle and shining, as well as the mandibles, the latter armed with six stout teeth; the extreme base of the scape pale testaceous. Thorax much narrower than the head, rounded anteriorly and compressed behind. Abdomen: the scale incrassate, narrowed to a thin edge at its upper margin, which is rounded; the scale is narrow, rounded in front and straight behind; the abdomen oblong-ovate; the head, thorax and abdomen have a few scattered, long, erect pale hairs.

 

Hab. Ceylon.

License not applicable

Smith, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Formica Dalmatica, Nyl. Addit. Alter. Adno. Mon. Form. Bor. 37.

 

Hab. Dalmatia.

License not applicable

Smith, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Formica , pt., Linn. Faun. Suec. 426 (1761); Syst. Nat. i. 962 (1766).

 

Lasius , pt., Fabr. Syst. Piez. 415 (1804).

 

Cataglyphis , Foerst. Hym. Stud. Form. 485 (1850).

 

Tapinoma , pt., Schenck, Besch. Nass. Ameis. 129 (1852).

 

Monocombus ,.Mayr. 110 (1855).

 

The maxillary palpi 6-jointed; the labial palpi 4-jointed. Ocelli 3, placed in a triangle on the vertex*. Males and females winged, constantly so in the former sex, temporarily so in the latter. The superior wings with one marginal and two submarginal cells; one division having also a complete discoidal cell, another in which it is obsolete; the petiole of the abdomen furnished with a single vertical scale. None of the individuals furnished with a sting. The pupae enclosed in silken cocoons.

License not applicable

Smith, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lingua brevis, rotundata. Palpi maxillares 6-articulati, labiales 4-articulati, dimidia longitudine priorum breviores. Antennffi fractae. Abdominis segmentum primum (s. petiolus) squama erecta plus minus compressa.

License not applicable

Förster, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Formica , pt, Linn. Faun. Suec. 426,1761. Lasius , pt, Fab. Syst. Piez. 415, 1804.

License not applicable

Smith, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Animal / associate
larva of Cetonia cuprea is associated with Formica

Animal / predator
Formica is predator of Neodiprion sertifer

In Great Britain and/or Ireland:
Animal / guest
Formicoxenus nitidulus is a guest in nest of Formica

Animal / predator
adult of Solenopsis fugax is predator of brood of Formica
Other: major host/prey

Animal / predator
Tetrao urogallus is predator of adult of Formica

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records: 5345
Specimens with Sequences: 5128
Specimens with Barcodes: 4979
Species: 109
Species With Barcodes: 107
Public Records: 1404
Public Species: 29
Public BINs: 26
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Formica sp. 05

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Formica sp. 06

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Formica sp. 02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Formica sp. 04

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Formica sp. 03

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Formica sp. 01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Formica fusca_nr

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Formica neorufibarbis_cf

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Formica lasioides_cf

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Formica CA01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Formica US03

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Formica neorufibarbis_3

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 92 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTCTTTATTTCTTATTTGCTATTTGAGCAGGAATAATTGGATCTTCTATAAGTATAATTATTCGTTTAGAATTAGGCTCATCAAATTCATTAATCAATAATGATCAAATTTATAATTCCTTAGTAACTAATCACGCTTTTATCATAATTTTTTTCATAGTAATACCATTTATAATTGGTGGATTTGGAAATTTTCTAATTCCTTTAATATTAGGATCTCCAGACATAGCTTATCCTCGTATAAATAATATAAGATTTTGACTTTTACCCCCTTCTATTACTCTTTTACTTTTAAGAAATTTTATTAATGATGGTACAGGAACAGGATGGACTATTTATCCCCCTTTAGCTTCAAATATTTTTCATAATGGTCCTTCTGTAGACTTAACAATTTTCTCTCTTCATATTGCAGGTATATCTTCAATTTTAGGGGCAATTAACTTTATTTCAACAATTCTTAATATACATCATAAAAATTTTTCTATTGATAAAATTCCTTTACTTGTATGATCAATTTTAATTACAGCTATCTTACTTCTATTATCCTTACCTGTTTTAGCAGGGGCTATCACTATACTATTAACTGACCGAAATTTAAATACTTCATTTTTTGATCCTTCAGGAGGTGGTGACCCAATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Formica neorufibarbis_3

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 81
Specimens with Barcodes: 87
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Formica neorufibarbis_1

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTCTTTATTTCTTATTTGCTATTTGAGCAGGAATAATTGGATCTTCTATAAGTATAATTATTCGTTTAGAATTAGGCTCATCAAATTCATTAATCAATAATGATCAAATTTATAATTCCTTAGTAACTAATCACGCTTTTATCATAATTTTTTTCATAGTAATACCATTTATAATTGGCGGATTTGGAAATTTTCTAATTCCTTTAATATTAGGATCTCCAGACATAGCTTATCCTCGTATAAATAATATAAGATTTTGACTTTTACCCCCTTCTATTACTCTTTTACTTTTAAGAAATTTTATTAATGATGGTACAGGAACAGGATGGACTATTTATCCCCCTTTAGCTTCAAATATTTTTCATAATGGTCCTTCTGTAGACTTAACAATTTTCTCTCTTCATATTGCAGGTATATCTTCAATTTTAGGGGCAATTAACTTTATTTCAACAATTCTTAATATACATCATAAAAATTTTTCTATTGATAAAATTCCTTTACTTGTATGATCAATTTTAATTACAGCTATCTTACTTCTATTATCCTTACCTGTTTTAGCAGGGGCTATCACTATACTATTAACTGACCGAAATTTAAATACTTCATTTTTTGATCCTTCAGGGGGGGGTGACCCAATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Formica neorufibarbis_1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 56
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Formica neorufibarbis_2

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 317 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTCTTTACTTTTTATTTGCTATTTGAGCAGGAATAATTGGATCTTCTATAAGTATAATTATTCGCTTAGAGTTAGGCTCATCAAATTCATTAATCAATAATGATCAAATTTATAATTCTTTAGTAACTAATCACGCTTTTATTATAATTTTTTTCATAGTAATACCATTTATAATTGGTGGATTTGGAAATTTTCTAATTCCTTTAATATTAGGATCTCCAGACATAGCTTATCCTCGTATAAATAATATAAGATTTTGACTTTTACCTCCTTCTATTACTCTTTTACTTCTAAGAAATTTTATTAATGATGGTACAGGAACAGGATGAACTATTTACCCCCCTTTAGCTTCAAATATTTTTCATAATGGTCCTTCTGTAGACTTAACAATTTTTTCTCTTCATATTGCAGGAATATCCTCAATTTTAGGAGCAATTAATTTTATTTCAACAATTCTTAATATACATCATAAAAATTTTTCTATCGATAAAATTCCCTTACTTGTATGATCAATTTTAATCACAGCTATCTTACTTCTATTATCTTTACCAGTTTTAGCAGGAGCTATTACTATACTATTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCTTCAGGAGGGGGTGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Formica neorufibarbis_2

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 276
Specimens with Barcodes: 303
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Formica sibylla_cf

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Formica cf. argentea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Formica n. sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Formica ca01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Formica

For the plastic, see Formica (plastic).

Formica is a genus of ants of the family Formicidae, commonly known as wood ants, mound ants, thatching ants, and field ants. Formica is the type genus of the Formicidae, and of the subfamily Formicinae.[3] The type species of genus Formica is the European red wood ant Formica rufa.[1]

Habitat[edit]

As the name wood ant implies, many Formica species live in wooded areas where there exists no shortage of material with which they can thatch their mounds. One shade-tolerant species is F. lugubris. However, sunlight is important to most Formica species, and colonies rarely survive for any considerable period in deeply shaded, dense woodland. The majority of species, especially outside the rufa species group, are inhabitants of more open woodlands or treeless grassland or shrubland. In North America, at least, these habitats had a long history of frequent landscape-scale fires that kept them open before European settlement. Conversion to agriculture and fire suppression have reduced the abundance of most American Formica, while the cessation of traditional haycutting seems to have had the same effect in Europe. However, at least a few Formica species may be found in a wide range of habitats from cities to seasides to grasslands to swamps to forests of the temperate Northern Hemisphere.[citation needed]

Nests[edit]

F. obscuripes mound (left) and a Formica mound on a rotting stump with worker ants (right)

Mound building, forest dwelling Formica such as F. rufa often have a considerable effect on their environment. They maintain large populations of aphids on whose secretions they feed, and the ants defend them from other predators. They also prey on other insects. In fact in many countries they are introduced in forests to control tree pests, such as swains jack pine sawfly and eastern tent caterpillars in North America. The effects of mound-building grassland species such as F. montana are not well-studied but their local abundance, conspicuous mound-building and very frequent association with aphids and membracids points to a comparably important ecological role.[citation needed]

Formica nests are of many different types from simple shaft-and-chamber excavations in soil with a small crater or turret of soil above to large mounds, under stones or logs, or in stumps. None are arboreal. The genus is abundant in both the Nearctic and Palearctic Regions. Due to their relatively large size and diurnal activity, they are among the more commonly seen ants in northern North America.[citation needed] Some species, including F. rufa, which is common in Southern England, make large visible thatch nests of dry plant stems, leaves, or conifer needles, usually based around a rotting stump.

Most Formica species are polygynous (having multiple queens per colony), and some are polydomous (having multiple nests belonging to the same colony).[4] Queens may be singly or multiply mated, and may or may not be related. Formica polyctena is one species that has polygynous colonies.[5]

Wood ants typically secrete formic acid; Formica rufa can squirt the acid from its acidopore several feet if alarmed, a habit which may have given rise to the archaic term for ant, pismire", and by analogy its American equivalent "piss-ant". They can be relatively large: F. rufa workers can reach a maximum length of around 10 mm. The eastern US species F. dolosa and the western F. ravida (syn. F. haemorrhoidalis) may be slightly longer.[citation needed]

"Slave-making" behavior[edit]

Formica are notable for their parasitic and slave making behaviors. There are three categories:[citation needed]

  • In the exsecta and rufa-microgyna groups, virgin queens cannot start colonies on their own, but invade colonies of other groups and by various processes eventually oust the host queen and have the host workers help them raise their own brood. Eventually the colony consists of only the invading queen's offspring. This is called temporary social parasitism.[citation needed]
  • In the sanguinea group, colonies are started as above, but in some species workers raid colonies of other groups for new workers to act as a work force, so-called slaves. F. sanguinea performs this behavior.[6]

Some species of this group need to do this to survive, for others it is optional.[citation needed]

  • The pallidefulva, neogagates, and fusca groups are those most often parasitized by the above groups. They are also enslaved by ants of the genus Polyergus. The evolution of this behavior is believed ultimately to have been derived from the common habit of many Formica species of adopting recently mated queens into established colonies. Indeed, in many of the parasitic species outside the "slave-makers", this "secondary polygyny" is common.[citation needed]

Species[edit]

Formica accreta worker, with cocoons

As of 2014, Formica contains 175 extant species and 55 extinct species.[2]

Species include:[7]

References[edit]

Notes[edit]

  1. ^ a b "Genus: Formica". antweb.org. AntWeb. Retrieved 23 September 2013. 
  2. ^ a b Bolton, B. (2014). "Formica". An online catalog of the ants of the world. Retrieved 17 July 2014. 
  3. ^ "Family: Formicidae". antweb.org. AntWeb. Retrieved 2 October 2013. 
  4. ^ Klotz, 2008: p. 33
  5. ^ Helantera, Heikki, and Liselotte Sundström. “Worker Reproduction in Formica Ants.” The American Naturalist , Vol. 170, No. 1 (July 2007).
  6. ^ cf. P. Huber via Darwin's Origin of Species, in Chapter VIII. Instinct[unreliable source?]
  7. ^ Formica species list. Integrated Taxonomic Information System (ITIS).

Bibliography[edit]

  • Klotz, J. H. (2008). "Formicinae". Urban ants of North America and Europe: identification, biology, and management. Cornell University Press. ISBN 978-0-8014-7473-6. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!