Physical Description

Diagnostic Description

In the F microgyna subgroup, within the F rufa-group .

License not applicable

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In California the members of this genus are most prevalent in montane habitats, although a few species occur in drier, low elevation sites. Formica species are ground-nesting ants with generalist foraging habits. Francoeur’s (1973) authoritative revision of the Formica fusca-group allows the species in that group to be relatively easily identified. Taxonomic difficulties still plague the Formica rufa-group , which contains most of the remaining species in California.

 

Species identification: keys in Francoeur (1973), Wheeler and Wheeler (1986g), Snelling and Buren (1985) and Mackay and Mackay (2002). Additional references: Agosti (1994b), Agosti and Bolton (1990b), Buren (1968a), Cole (1956d, 1956f, 1956g), Creighton(1940a, 1950a), Dlussky (1967), Francoeur and Snelling (1979), Gösswald (1989, 1990), Savolainen (1998), Smith (1979), Trager et al. (2005), Wilson and Brown (1955).

License not applicable

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Latr. Fabr. Zett. Lepelet. de S: t Farg. Dahlbom. Losana.

 

Corpus majoris, mediae vel parvae staturae. Lingua brevis rotundata. Palpi maxillares 6 - articulati, labiales 4 - articulati dimidia longitudiue priorum breviores. Antennae fractae valde vibrabiles; scopus longitudine dimidiae vel saltem plus quam tertae partis tonus antennae.

 

Operaria magnitudine est maris vel parum major aut minor, formatione capitis ejusque partium sicut feminae, praeter quod in nonnullis speciebus nulla habeat stemmata. Thorax anterius rotundatus capite semper gracilior, lateribus compressis, dorso in aliis aequali, in aliis medio immerso locoque scutelli elevatiusculo. Abdomen ovato-rotundatum capite latius, longitudiue thoracis *). Pedes tarsis longioribus gracilioribus quam in femina.

 

Femina saepissime major est quam operaria et mas. Mandibulae latae robustae, apice denticulatae. Antennae 12 - articutatae

 

(praeter radiculam), capite duplo longiores, flagello filiformi versus apicem perparum incrassato. Ocelli semper adsunt. Thorax compresso-subovatus duplo fere altior et latior quam operaria, scutello ejusdem altitudinis ac dorsum thoracis. Alae amplae, anteriores corpore saepissime paullo longiores, posteriores abdomen excedentes; nervi conspicui, area radialis anguste triangularis clausa, areae cubitales binae angulis acutissimis invicem conterminae, et in plurimis nostris adhuc area discoidalis trapezoidea, basi areae cubitalis primae aduexa, obveniunt. Pedes tibiis anticis intus versus apices saepissime parce spinulosis vel setulosis. Abdomen 5 - annulatum capite latius et thorace nonnihil longius oblongo-rotundatum depressiusculum vel subglobosum et tum brevius. Genitalia inclusa intra ultimum segmentum.

 

Mas plerumque femina multo minor, sed interdum ejusdem magnitudinis. Caput multo minus quam in femina, minusque adhuc quam in operaria, mandibulis fere triplo saepissime angustioribus quam in iis oculisque magis prominulis. Antennae 13 - articulatae graciliores quam in femina, flagello aequali. Thorax gibbosus. Alae ut in femina, corporis circiter longitudine. Abdomen 6 - annulatum latitudine thoracis, longitudine thoracis capitisque, subconicum supra deplanatus, ano aliquantum angustato et deflexo, genitalibus ad partem exsertis valvulaque ventrali subtus suffultis. Partes genitalium procedentes varie formatae praecipue sunt: squamutae laterales, penicilli dorsales pilosuli membranula versus basin conjuncti, vaginae externae et internae atque inter has ambas utrinque partes vaginantes aliae breviores unco in apice: saepe munitae (vaginae intermediae). Tarsi graciliores quam in operariis, pulvillis et unguiculis magnis.

 

Subdivis. 1. [[ worker ]] et [[ queen ]] corpore in hoc genere maximo, [[ worker ]] stemmatibus nullis, thoracis lateribus valde compressis, dorso aequali, [[ queen ]] [[ male ]] planiusculo. Alae area discoidali nulla. [[ queen ]] abdomine oblongo-rotundato. [[ male ]] genitalibus parvis, vaginis angustis, externis rectis.

License not applicable

Nylander, W.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This genus comprises two distinct forms, the one with spines on the thorax, the other unarmed, which certainly ought to form two genera, inasmuch as this distinction is made to separate Atta from Ocodoma .

 

1 st, without spines on the thorax.

License not applicable

Jerdon, T. C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

without " sting, the antennae inserted near the forehead, and with triangular jaws; abdominal pedicle of only one knot or scale.

License not applicable

Jerdon, T. C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Formica Chilensis , Spin. Faun. Chili, vi. 237. 2 [[worker]].

 

Hab. Chili.

License not applicable

Smith, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Worker. Length 4 1/2 lines.-Black: the flagellum, thorax, legs and scale of the peduncle rufo-testaceous; the tibiae and basal joint of the tarsi more or less dusky; head large and cordate; eyes ovate, placed above the middle at the sides of the head; the head opake; the clypeus subcarinate in the middle and shining, as well as the mandibles, the latter armed with six stout teeth; the extreme base of the scape pale testaceous. Thorax much narrower than the head, rounded anteriorly and compressed behind. Abdomen: the scale incrassate, narrowed to a thin edge at its upper margin, which is rounded; the scale is narrow, rounded in front and straight behind; the abdomen oblong-ovate; the head, thorax and abdomen have a few scattered, long, erect pale hairs.

 

Hab. Ceylon.

License not applicable

Smith, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Formica Dalmatica, Nyl. Addit. Alter. Adno. Mon. Form. Bor. 37.

 

Hab. Dalmatia.

License not applicable

Smith, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Formica , pt., Linn. Faun. Suec. 426 (1761); Syst. Nat. i. 962 (1766).

 

Lasius , pt., Fabr. Syst. Piez. 415 (1804).

 

Cataglyphis , Foerst. Hym. Stud. Form. 485 (1850).

 

Tapinoma , pt., Schenck, Besch. Nass. Ameis. 129 (1852).

 

Monocombus ,.Mayr. 110 (1855).

 

The maxillary palpi 6-jointed; the labial palpi 4-jointed. Ocelli 3, placed in a triangle on the vertex*. Males and females winged, constantly so in the former sex, temporarily so in the latter. The superior wings with one marginal and two submarginal cells; one division having also a complete discoidal cell, another in which it is obsolete; the petiole of the abdomen furnished with a single vertical scale. None of the individuals furnished with a sting. The pupae enclosed in silken cocoons.

License not applicable

Smith, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lingua brevis, rotundata. Palpi maxillares 6-articulati, labiales 4-articulati, dimidia longitudine priorum breviores. Antennffi fractae. Abdominis segmentum primum (s. petiolus) squama erecta plus minus compressa.

License not applicable

Förster, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Formica , pt, Linn. Faun. Suec. 426,1761. Lasius , pt, Fab. Syst. Piez. 415, 1804.

License not applicable

Smith, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Associations

Animal / associate
larva of Cetonia cuprea is associated with Formica

Animal / predator
Formica is predator of Neodiprion sertifer

In Great Britain and/or Ireland:
Animal / guest
Formicoxenus nitidulus is a guest in nest of Formica

Animal / predator
adult of Solenopsis fugax is predator of brood of Formica
Other: major host/prey

Animal / predator
Tetrao urogallus is predator of adult of Formica

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Formica fusca_nr

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Formica neorufibarbis_cf

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Formica lasioides_cf

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Formica CA01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Formica US03

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Formica neorufibarbis_3

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 92 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTCTTTATTTCTTATTTGCTATTTGAGCAGGAATAATTGGATCTTCTATAAGTATAATTATTCGTTTAGAATTAGGCTCATCAAATTCATTAATCAATAATGATCAAATTTATAATTCCTTAGTAACTAATCACGCTTTTATCATAATTTTTTTCATAGTAATACCATTTATAATTGGTGGATTTGGAAATTTTCTAATTCCTTTAATATTAGGATCTCCAGACATAGCTTATCCTCGTATAAATAATATAAGATTTTGACTTTTACCCCCTTCTATTACTCTTTTACTTTTAAGAAATTTTATTAATGATGGTACAGGAACAGGATGGACTATTTATCCCCCTTTAGCTTCAAATATTTTTCATAATGGTCCTTCTGTAGACTTAACAATTTTCTCTCTTCATATTGCAGGTATATCTTCAATTTTAGGGGCAATTAACTTTATTTCAACAATTCTTAATATACATCATAAAAATTTTTCTATTGATAAAATTCCTTTACTTGTATGATCAATTTTAATTACAGCTATCTTACTTCTATTATCCTTACCTGTTTTAGCAGGGGCTATCACTATACTATTAACTGACCGAAATTTAAATACTTCATTTTTTGATCCTTCAGGAGGTGGTGACCCAATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Formica neorufibarbis_3

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 81
Specimens with Barcodes: 87
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Formica neorufibarbis_1

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTCTTTATTTCTTATTTGCTATTTGAGCAGGAATAATTGGATCTTCTATAAGTATAATTATTCGTTTAGAATTAGGCTCATCAAATTCATTAATCAATAATGATCAAATTTATAATTCCTTAGTAACTAATCACGCTTTTATCATAATTTTTTTCATAGTAATACCATTTATAATTGGCGGATTTGGAAATTTTCTAATTCCTTTAATATTAGGATCTCCAGACATAGCTTATCCTCGTATAAATAATATAAGATTTTGACTTTTACCCCCTTCTATTACTCTTTTACTTTTAAGAAATTTTATTAATGATGGTACAGGAACAGGATGGACTATTTATCCCCCTTTAGCTTCAAATATTTTTCATAATGGTCCTTCTGTAGACTTAACAATTTTCTCTCTTCATATTGCAGGTATATCTTCAATTTTAGGGGCAATTAACTTTATTTCAACAATTCTTAATATACATCATAAAAATTTTTCTATTGATAAAATTCCTTTACTTGTATGATCAATTTTAATTACAGCTATCTTACTTCTATTATCCTTACCTGTTTTAGCAGGGGCTATCACTATACTATTAACTGACCGAAATTTAAATACTTCATTTTTTGATCCTTCAGGGGGGGGTGACCCAATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Formica neorufibarbis_1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 56
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Formica neorufibarbis_2

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 317 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTCTTTACTTTTTATTTGCTATTTGAGCAGGAATAATTGGATCTTCTATAAGTATAATTATTCGCTTAGAGTTAGGCTCATCAAATTCATTAATCAATAATGATCAAATTTATAATTCTTTAGTAACTAATCACGCTTTTATTATAATTTTTTTCATAGTAATACCATTTATAATTGGTGGATTTGGAAATTTTCTAATTCCTTTAATATTAGGATCTCCAGACATAGCTTATCCTCGTATAAATAATATAAGATTTTGACTTTTACCTCCTTCTATTACTCTTTTACTTCTAAGAAATTTTATTAATGATGGTACAGGAACAGGATGAACTATTTACCCCCCTTTAGCTTCAAATATTTTTCATAATGGTCCTTCTGTAGACTTAACAATTTTTTCTCTTCATATTGCAGGAATATCCTCAATTTTAGGAGCAATTAATTTTATTTCAACAATTCTTAATATACATCATAAAAATTTTTCTATCGATAAAATTCCCTTACTTGTATGATCAATTTTAATCACAGCTATCTTACTTCTATTATCTTTACCAGTTTTAGCAGGAGCTATTACTATACTATTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCTTCAGGAGGGGGTGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Formica neorufibarbis_2

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 276
Specimens with Barcodes: 303
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Formica sibylla_cf

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Formica cf. argentea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Formica n. sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Formica ca01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:2,484Public Records:806
Specimens with Sequences:2,214Public Species:15
Specimens with Barcodes:2,087Public BINs:11
Species:100         
Species With Barcodes:93         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Formica

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Formica

A worker ant in the Formica pallidefulva group
A Formica obscuripes mound
A typical Formica mound on a rotting stump, covered by worker ants going out to forage, as they do on dry days.

Formica is a genus of ants of the family Formicidae, commonly known as wood ants, mound ants, thatching ants, or field ants. Formica is the type genus of the Formicidae, and of the subfamily Formicinae. In turn Formica's own type species is the European red wood ant Formica rufa.[citation needed]

Contents

Habitat

As the name wood ant implies, many Formica species live in wooded areas where there exists no shortage of material with which they can thatch their mounds. The most shade tolerant species are F. lugubris in Eurasia and F. subaenescens (fusca) in North America. However, sunlight is important to most Formica species, and colonies rarely survive for any considerable period in deeply shaded, dense woodland. The majority of species, especially outside the rufa species group, are inhabitants of more open woodlands or treeless grassland or shrubland. In North America, at least, these habitats had a long history of frequent landscape-scale fires that kept them open before European settlement. Conversion to agriculture and fire suppression have reduced the abundance of most American Formica, while the cessation of traditional haycutting seems to have had the same effect in Europe. However, at least a few Formica species may be found in a wide range of habitats from cities to seasides to grasslands to swamps to forests of the temperate Northern Hemisphere.[citation needed]

Nests

Mound building, forest dwelling Formica like F. rufa often have a considerable effect on their environment. They maintain large populations of aphids on whose secretions they feed, and the ants defend them from other predators. They also prey on other insects. In fact in many countries they are introduced in forests to control tree pests, such as swains jack pine sawfly and eastern tent caterpillars in North America. The effects of mound-building grassland species such as F. montana are not well-studied but their local abundance, conspicuous mound-building and very frequent association with aphids and membracids points to a comparably important ecological role.[citation needed]

Formica nests are of many different types from simple shaft-and-chamber excavations in soil with a small crater or turret of soil above to large mounds, under stones or logs, or in stumps. None are arboreal. The genus is abundant in both the Nearctic and Palearctic Regions. Due to their relatively large size and diurnal activity, they are among the more commonly seen ants in northern North America.[citation needed] Some species, including Formica rufa, which is common in Southern England, make large visible thatch nests of dry plant stems, leaves, or conifer needles, usually based around a rotting stump.

Most Formica species are polygynous (having multiple queens per colony), and some are polydomous (having multiple nests belonging to the same colony).[1] Queens may be singly or multiply mated, and may or may not be related.

Wood ants typically secrete formic acid; F. rufa can squirt the acid from its acidopore several feet if alarmed, a habit which may have given rise to the archaic term for ant pismire, and by analogy its American equivalent piss-ant. They can be relatively large: F. rufa workers can reach a maximum length of around 10 mm. The eastern US species F. dolosa and the western F. ravida (=haemorrhoidalis) may reach slightly greater lengths.[citation needed]

"Slave-making" behavior

Formica are notable for their parasitic and slave making behaviors. There are three categories:[citation needed]

  • In the exsecta and rufa-microgyna groups, virgin queens cannot start colonies on their own, but invade colonies of other groups and by various processes eventually oust the host queen and have the host workers help them raise their own brood. Eventually the colony consists of only the invading queen's offspring. This is called temporary social parasitism.[citation needed]
  • In the sanguinea group, colonies are started as above, but then in some species of the group workers go out and raid colonies of other groups for new workers to act as a work force, so-called slaves. Some species of this group need to do this to survive, for others it is optional.[citation needed]
  • The pallidefulva, neogagates, and fusca groups are those most often parasitized by the above groups. They are also enslaved by ants of the genus Polyergus. The evolution of this behavior is believed ultimately to have been derived from the common habit of many Formica species of adopting recently mated queens into established colonies. Indeed, in many of the parasitic species outside the "slave-makers", this "secondary polygyny" is common.[citation needed]

Species

There are many species of Formica (ITIS records nearly 200).

References

Notes

Bibliography

  • Klotz, John H. (2008). "Formicinae". Urban ants of North America and Europe: identification, biology, and management. Cornell University Press. ISBN 978-0-8014-7473-6. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!