Physical Description

Type Information

Syntype for Calyptogena pacifica Dall, 1891
Catalog Number: USNM 222323
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Locality: Clarence Strait, Alaska, United States, Gulf of Alaska, North Pacific Ocean
Depth (m): 589 to 589
Vessel: Albatross R/V
  • Syntype: Dall, W. H. 1891. Proc. U.S. Natl. Mus. 14(849): 190.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Calyptogena pacifica Dall, 1891
Catalog Number: USNM 122549
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): United States Fish Commission
Locality: Clarence Strait, Alaska, United States, North Pacific Ocean
Depth (m): 589 to 589
Vessel: Albatross R/V
  • Syntype: Proc. U.S. Natl. Mus. 14(849): 190.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Calyptogena pacifica Dall, 1891
Catalog Number: USNM 206424
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Locality: Clarence Strait, Alaska, United States, Gulf of Alaska, North Pacific Ocean
Depth (m): 589 to 589
Vessel: Albatross R/V
  • Syntype: Dall, W. H. 1891. Proc. U.S. Natl. Mus. 14(849): 190.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 1100 - 2415
  Temperature range (°C): 1.744 - 3.359
  Nitrate (umol/L): 34.711 - 43.402
  Salinity (PPS): 34.443 - 34.634
  Oxygen (ml/l): 0.438 - 3.998
  Phosphate (umol/l): 2.419 - 3.221
  Silicate (umol/l): 68.288 - 176.733

Graphical representation

Depth range (m): 1100 - 2415

Temperature range (°C): 1.744 - 3.359

Nitrate (umol/L): 34.711 - 43.402

Salinity (PPS): 34.443 - 34.634

Oxygen (ml/l): 0.438 - 3.998

Phosphate (umol/l): 2.419 - 3.221

Silicate (umol/l): 68.288 - 176.733
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 637 - 1600
  Temperature range (°C): 3.013 - 5.284
  Nitrate (umol/L): 40.403 - 43.616
  Salinity (PPS): 34.287 - 34.603
  Oxygen (ml/l): 0.303 - 0.759
  Phosphate (umol/l): 3.251 - 3.360
  Silicate (umol/l): 94.255 - 161.882

Graphical representation

Depth range (m): 637 - 1600

Temperature range (°C): 3.013 - 5.284

Nitrate (umol/L): 40.403 - 43.616

Salinity (PPS): 34.287 - 34.603

Oxygen (ml/l): 0.303 - 0.759

Phosphate (umol/l): 3.251 - 3.360

Silicate (umol/l): 94.255 - 161.882
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Vesicomya pacifica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 22 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGCGCTAGAGTTTTAGGGGAT---AGGCATTTGTACCAAGTAGTAGTTACTGCACATGGGTTATTAATAATCTTTTTTTTAGTAATACCAATAATGATTGGGGGTTTTGGTAATTGGTTGGTTCCTTTAATGTTGCAGATTCCAGATATGGCTTTTCCACGGATGAATAATCTGAGGTTTTGATTAATACCTAGATCGGTTTTAATGTTGCTTGGGTCTGCTTATGTAGAAAGTGGAGCGGGAACTGGTTGGACTATTTATCCTCCATTATCTAGGATTATAGGTCATGCCGGCCCTTCTGTGGATTTTGTAATTTTATCTTTACATTTAGGTGGTGTGTCTTCCATTTTAGCTTCTATTAATTTTGTAGTTACTTCTCTTTGTATGCGTGTTGAAGCTTTATCTTTACTGCGTGTGACTATATTTGTTTGGTGTGTTGCTGTTACTGGTTTTTTATTAATTATTGCTATGCCTGTTTTGGCTGGGAGGTTAACAATATTATTAACTGATCGTAAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Vesicomya pacifica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!