Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Quahogs can reach a very ripe old age, more than 400 years!. That makes them the oldest animals in the world. However, more than 99% of the quahogs do not come close to growing so old, due to the beam-trawl fisheries. Traces of damage can often be discovered in the year rings.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

The Ocean Quahog, or Black Clam (Arctica islandica) is broadly distributed in the boreal-temperate zone of the North Atlantic. It is found from the Barents Sea (Arctic Ocean north of Scandinavia and Russia) to the Gulf of Cadiz (south of Portugal) in the eastern Atlantic (where it is abundant in some regions characterized by important oceanographic fronts, such as Iceland and the boundary between the lrminger and East Greenland currents) (Scourse et al. 2006) and from Newfoundland (Canada) to North Carolina (U.S.A.) in the western Atlantic, where it is a is a common beach shell from Cape Cod northward. It is found in sand at depths from 5 to 500 meters (Scourse et al. 2006). This orange-fleshed clam, which may reach 10 cm in size, is fished commercially to a limited degree from Rhode Island south to Virginia (U.S.A.). (Abbott 1968; Morris 1973; Gosner 1978; Rehder 1981)

The Ocean Quahog may have the longest lifespan of any animal known. These clams mature at 10 to 32 years of age (Abele et al. 2009), but individuals more than 100 years old are common and reported maximum ages from various studies are 225, 268, and 374 years old. Patterns of shell growth in these clams have been used to infer historical climate changes at a range of time scales. (Schöne et al. 2005 and references therein; Scourse et al. 2006; Abele et al. 2008). These clams have also been investigated by researchers studying cellular, molecular, and genetic aspects of aging (Abele et al. 2008, 2009; Bodnar 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

 Arctica islandica has a heavy, thick, oval to rounded shell up to 13 cm in length. The shell is sculptured with numerous fine concentric lines and the beaks are anterior. It has a thick glossy periostracum that is brown in smaller individuals, becoming greenish-brown to black in larger specimens. The periostracum peels away on dead shells, revealing a white to pale brown shell beneath.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Arctic Ocean, Atlantic, Bay of Biscay, Belgian Exclusive Economic Zone, British Isles, Clam Cove, Cobscook Bay, Deadmans Harbour, Dutch Exclusive Economic Zone, European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Maine, Gulf of St. Lawrence, Hardwood Island, Irish Exclusive economic Zone, L'Etang, North East Atlantic, North Sea, North West Atlantic, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, USA, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Arctic to Cape Hatteras
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Lutz et al. (1982) recorded prodissoconch I lengths ranging from 98 to 118 micrometers in a sample of 50 cultured individuals. Prodissoconch II lengths were found to range between 232 to 289 micrometers in a sample of 100 early post-larval cultured specimens.

Byssal threads are apparently not secreted by early post-larval individuals (Lutz et al., 1982).

The exhalant aperture and siphon develop earlier than the inhalant ones. Mantle fusion delimiting a inhalant aperture occurs when specimens reach a shell length of approximately 1 mm (Lutz et al., 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sartori, André F.

Source: Molluscs - eBivalvia LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

infralittoral and circalittoral of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from rocky shores.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2638 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1550 samples.

Environmental ranges
  Depth range (m): 0 - 1240
  Temperature range (°C): -0.262 - 22.695
  Nitrate (umol/L): 1.175 - 23.955
  Salinity (PPS): 27.165 - 36.359
  Oxygen (ml/l): 3.835 - 7.573
  Phosphate (umol/l): 0.093 - 1.571
  Silicate (umol/l): 1.808 - 17.288

Graphical representation

Depth range (m): 0 - 1240

Temperature range (°C): -0.262 - 22.695

Nitrate (umol/L): 1.175 - 23.955

Salinity (PPS): 27.165 - 36.359

Oxygen (ml/l): 3.835 - 7.573

Phosphate (umol/l): 0.093 - 1.571

Silicate (umol/l): 1.808 - 17.288
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Arctica islandica is found at extreme low water level but predominately on sub-littoral firm sediments including level offshore areas, buried (or part buried) in sand and muddy sand that ranges from fine to coarse grains.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Stellwagen Bank Benthic Community

 

The species associated with this article partially comprise the benthic community of Stellwagen Bank, an undersea gravel and sand deposit stretching between Cape Cod and Cape Ann off the coast of Massachusetts. Protected since 1993 as part of the Stellwagen Bank National Marine Sanctuary, the bank is known primarily for whale-watching and commercial fishing of cod, lobster, hake, and other species (Eldredge 1993). 

The benthic community of Stellwagen Bank is diverse and varied, depending largely on the grain size of the substrate. Sessile organisms such as bryozoans, ascidians, tunicates, sponges, and tube worms prefer gravelly and rocky bottoms, while burrowing worms, burrowing anemones, and many mollusks prefer sand or mud surfaces (NOAA 2010). Macroalgae, such as kelps, are exceedingly rare in the area — most biogenic structure along the bottom is provided by sponges, cnidarians, and worms. The dominant phyla of the regional benthos are Annelida, Mollusca, Arthropoda, and Echinodermata (NOAA 2010). 

Ecologically, the Stellwagen Bank benthos contributes a number of functions to the wider ecosystem. Biogenic structure provided by sessile benthic organisms is critical for the survivorship of juveniles of many fish species, including flounders, hake, and Atlantic cod. The benthic community includes a greater than average proportion of detritivores — many crabs and filter-feeding mollusks — recycling debris which descends from the water column above (NOAA 2010). Finally, the organisms of the sea-bed are an important source of food for many free-swimming organisms. Creatures as large as the hump-backed whale rely on the benthos for food — either catching organisms off the surface or, in the whale’s case, stirring up and feeding on organisms which burrow in sandy bottoms (Hain et al 1995). 

As a U.S. National Marine Sanctuary, Stellwagen Bank is nominally protected from dredging, dumping, major external sources of pollution, and extraction of mammals, birds or reptiles (Eldredge 1993). The benthic habitat remains threatened, however, by destructive trawling practices. Trawl nets are often weighted in order that they be held against the bottom, flattening soft surfaces, destroying biogenic structure, and killing large numbers of benthic organisms. There is also occasional threat from contaminated sediments dredged from Boston harbor and deposited elsewhere in the region (NOAA 2010). The region benefits from close observation by NOAA and the Woods Hole Oceanographic Institute, however, and NOAA did not feel the need to make any special recommendations for the preservation of benthic communities in their 2010 Management Plan and Environmental Assessment. 

  • Eldredge, Maureen. 1993. Stellwagen Bank: New England’s first sanctuary. Oceanus 36:72.
  • Hain JHW, Ellis SL, Kenney RD, Clapham PJ, Gray BK, Weinrich MT, Babb IG. 1995. Apparent bottom feeding by humpback-whales on Stellwagen Bank. Marine Mammal Science 11, 4:464-479.
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Section IV: Resource States” pp. 51-143. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Appendix J: Preliminary Species List for the SBNMS” pp. 370-381. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Stages in the life cycle include a trocophore and a veliger larvae, as in most other bivalves. In larval cultures kept under laboratory conditions, Lutz et al. (1982) recorded a minimum time to settlement of 32 days after fertilization at a temperature of approximately 13 °C; and of approximately 55 days at temperatures between 8.5 and 10°C.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sartori, André F.

Source: Molluscs - eBivalvia LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 400 years (wild) Observations: These animals show exceptional longevity and have been estimated to live up to 400 years in the wild. One study found that in animals aged 4-192 years, antioxidant enzymes declined rapidly in the first 25 years, which includes the growth and sexual maturity stages, but afterwards remained stable for over 150 years (Abele et al. 2008). Though more detailed studies are warranted, it appears this species is a case of negligible senescence.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

The eggs display individual capsules which envelop both unfertilized and fertilized eggs, and are also frequently observed encircling the early cleavage stages, up to at least the 16-celled stage. Eggs are approximately 75 to 90 micrometers in diameter (Lutz et al., 1982).

The sperm possesses unusually long tails (Lutz et al., 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sartori, André F.

Source: Molluscs - eBivalvia LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Arctica islandica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTTTATACTTTATTTTTTCTATTTGAGCAGGATTAATAGGAACTGGTTTTAGAGTAATTATTCGGATAGAATTGGCTATACCTGGCTCTCTCTTACAAGAT---GGTCAATTATATAATGTGATTGTAACTGCTCATGCTTTAGTGATGATTTTTTTTTTAGTAATGCCTATAATGATAGGAGGGTTCGGAAATTGATTAGTTCCATTAATGTTAACAGTACCGGACATAGCTTTTCCACGATTAAATAATTTGAGTTTTTGATTGTTGCCTATAGCTATATTACTTCTTTTGGGGTCGGGATATGTAGAGAGAGGGGCAGGAACTGGGTGAACTATCTATCCTCCTTTATCTAGTAATATTGCTCATGCAGGCCCTTCAATAGAATATGTAATTTTTTCTCTTCATCTAGGGGGAGCATCATCTATTTTAGCTTCTATTAATTTTGTTACCACTTCTTTCTGTATGCGTCCAGGAGTTCAACAATTACTTCGGACTACGTTGTTTGTGTGATGTATTGCGGTAACGGGGTTTTTATTAATTGTAGCTATGCCTGTTTTAGCAGGTGCGTTAACAATATTGTTAACTGACCGAAATTTTAATACTTCGTTTTTTGACCCGGTAGGGCTTGGAGATCCTGTGTTATTTGTTCATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Arctica islandica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Arctica islandica

The dark periostracum is flaking off this dried valve of Arctica islandica from Wales

Arctica islandica, common name the ocean quahog, is a species of edible clam, a marine bivalve mollusk in the family Arcticidae. This species is native to the North Atlantic Ocean, and it is harvested commercially as a food source. This species is also known by a number of different common names, including Icelandic cyprine,[1] mahogany clam, mahogany quahog, black quahog, and black clam.[2]

The typical Arctica islandica resembles the quahog, but the shell of the ocean quahog is rounder, the periostracum is usually black, and on the interior of the shell, the pallial line has no indentation, or sinus. Unlike the quahog, which lives intertidally and can be collected by clam digging, this species lives subtidally, and can only be collected by dredging. They grow to sizes exceeding 50 mm shell height.[3]

These animals show exceptional longevity with a maximum reported age of 507 years.[4] In 1868 one specimen, collected alive near Iceland, was 374 years old. The study of its growth rate and the oxygen isotope data showed that it had a highly variable growth at the peak of the Little Ice Age around 1550-1620 and mild climate near its end around 1765-1780 and had recorded the volcanic eruption of Mount Tambora in 1815.[5] One study found that in animals aged 4–192 years, antioxidant enzymes declined rapidly in the first 25 years, which includes the growth and sexual maturity stages, but afterwards remained stable for over 150 years. Though more detailed studies are warranted, it appears this species is a case of negligible senescence.[6]

See also

Notes

  1. ^ Sabatini, M. & Pizzola, P.F., 2007. Arctica islandica. Icelandic cyprine. Marine Life Information Network: Biology and Sensitivity Key Information Sub-programme [on-line]. Plymouth: Marine Biological Association of the United Kingdom. [cited 14 September 2007]. Available from: <http://www.marlin.ac.uk/species/Arcticaislandica.htm>
  2. ^ Hackney, Cameron R.; Thomas E. Rippen (2000). "The Molluscan Shellfish Industry". In Roy E. Martin, Emily Paine Carter, Jr., George J. Flick, Lynn M. Davis. Marine and Freshwater Products Handbook. CRC Press. pp. 323–324. ISBN 1-56676-889-6.
  3. ^ R. Witbaard, M.J.N. Bergman (2003). "The distribution and population structure of the bivalve Arctica islandica L. in the North Sea: what possible factors are involved?". Journal of Sea Research 50: 11–25. http://www.vliz.be/imisdocs/publications/56725.pdf.
  4. ^ Munro, D., and Blier P.U. (2012). The extreme longevity of Arctica islandica is associated with increased peroxidation resistance in mitochondrial membranes. Aging Cell 11(5): 845-55. doi: 10.1111/j.1474-9726.2012.00847.x. Epub 2012 Jul 25.
  5. ^ Schone B.R. et al. 2005. Palaeogeography, Palaeoclimatology, Palaeoecology 228, 130-148.
  6. ^ http://genomics.senescence.info/species/entry.php?species=Arctica_islandica
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!