Physical Description

Type Information

Syntype for Arca adamsi conradiana Dall, 1886
Catalog Number: USNM 92554
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Locality: Cape Hatteras, North Carolina, United States, North Atlantic Ocean
Depth (m): 90 to 90
Vessel: Albatross R/V
  • Syntype: Dall, W. H. 1886. Bull. Mus. Comp. Zool. 12(6): 243.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 90 - 90
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 90 - 90
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 34 specimens in 1 taxon.
Water temperature and chemistry ranges based on 15 samples.

Environmental ranges
  Depth range (m): 1 - 80.2
  Temperature range (°C): 22.044 - 26.293
  Nitrate (umol/L): 0.273 - 2.736
  Salinity (PPS): 36.080 - 37.147
  Oxygen (ml/l): 4.454 - 4.807
  Phosphate (umol/l): 0.070 - 0.194
  Silicate (umol/l): 0.805 - 2.067

Graphical representation

Depth range (m): 1 - 80.2

Temperature range (°C): 22.044 - 26.293

Nitrate (umol/L): 0.273 - 2.736

Salinity (PPS): 36.080 - 37.147

Oxygen (ml/l): 4.454 - 4.807

Phosphate (umol/l): 0.070 - 0.194

Silicate (umol/l): 0.805 - 2.067
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Arcopsis adamsi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGGTTTTGGTCAGCGTTAGTGGGAACCGGTTTAAGTATTCATATTCGATTAAATTTGGCTCAGCCAGGTGGGGTTTATAGGGATAACCCCCAACTGTATAATGTCATTGTAACTACCCATGCGCTAATAATAATTTTCTTTTTTGTTATGCCGACTTTAATGGGGGGATTTGGAAATTGATTAGTTCCATTGATGCTTGGTATTCCGGATCTTATCTTTGCGCGGGTTAATAATATAAGTTATTGGTTATTGCCTGGTCCTTTAGTGATGCTTATTAGGTCAGCAGGGATTGAGGGGGGGGCCGGTTCTGGATGGACAGTATACCCTCCTCTTTCTAGGAGAGAGTTTCATCCAACCCCAGCAATGGATTTAGTTATTTTTTCTTTACATATTGCTGGATTTGGGTCTATAATGAGGTCGTTAAATTTTATAGTAACTATTATTAGGGGCCGATTTTATGGGATGTTGCCTGAGCGTATAACTGTGTTTACGTGAGGGATGATAGTAACATCTTGACTATTGTTATTGTCATTGCCTGTATTGGCTGGGGGGTTAACTATGTTAATTACAGACCGTCATGTCAGAACATCATTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Arcopsis adamsi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!