Physical Description
Type Information
Paratype for Lepetodrilus gordensis Johnson et al., 2001
Catalog Number: USNM 1083160
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Locality: Gorda Ridge, at hydrothermal vent, Oregon, United States, North Pacific Ocean
Depth (m): 2715 to 2715
Vessel: Tiburon ROV
Catalog Number: USNM 1083160
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Locality: Gorda Ridge, at hydrothermal vent, Oregon, United States, North Pacific Ocean
Depth (m): 2715 to 2715
Vessel: Tiburon ROV
- Paratype: Johnson, S. B., et al. 2006. Migration, Isolation, and Speciation of Hydrothermal Vent Limpets (Gastropoda; Lepetodrilidae) Across the Blanco Transform Fault. Biol. Bull. 210
© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Trusted
Ecology
Habitat
Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.
Environmental ranges
Depth range (m): 2198.5 - 2701
Temperature range (°C): 1.771 - 1.924
Nitrate (umol/L): 39.961 - 42.195
Salinity (PPS): 34.596 - 34.634
Oxygen (ml/l): 1.469 - 1.944
Phosphate (umol/l): 2.903 - 3.054
Silicate (umol/l): 175.643 - 176.826
Graphical representation
Depth range (m): 2198.5 - 2701
Temperature range (°C): 1.771 - 1.924
Nitrate (umol/L): 39.961 - 42.195
Salinity (PPS): 34.596 - 34.634
Oxygen (ml/l): 1.469 - 1.944
Phosphate (umol/l): 2.903 - 3.054
Silicate (umol/l): 175.643 - 176.826
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 3 samples.
Environmental ranges
Depth range (m): 2198.5 - 2701
Temperature range (°C): 1.771 - 1.924
Nitrate (umol/L): 39.961 - 42.195
Salinity (PPS): 34.596 - 34.634
Oxygen (ml/l): 1.469 - 1.944
Phosphate (umol/l): 2.903 - 3.054
Silicate (umol/l): 175.643 - 176.826
Graphical representation
Depth range (m): 2198.5 - 2701
Temperature range (°C): 1.771 - 1.924
Nitrate (umol/L): 39.961 - 42.195
Salinity (PPS): 34.596 - 34.634
Oxygen (ml/l): 1.469 - 1.944
Phosphate (umol/l): 2.903 - 3.054
Silicate (umol/l): 175.643 - 176.826
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Lepetodrilus gordensis
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 42 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 42 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GGTACTGCACTAAGAATTCTTATTCGAGCTGAACTCGGGCAGCCGGGAGCTCTTTTAGGAGAC---GACCAACTCTATAATGTAATTGTTACTGCTCATGCATTTGTAATAATTTTTTTCTTAGTCATGCCCCTGATAATTGGGGGGTTCGGAAACTGACTAGTGCCCCTAATGCTAGGGGCTCCTGACATAGCTTTCCCTCGGCTTAACAATATAAGCTTCTGGCTTCTTCCCCCTTCACTCAGTCTCCTCTTAACCTCAGCTGCGGTTGAAAGAGGTGCCGGAACAGGATGAACAGTCTATCCTCCTCTAGCTGGCAATCTAGCTCACGCCGGTGGATCAGTTGATTTAACAATTTTCTCTCTCCATTTAGCCGGTGTATCTTCCATTTTAAGTTCTGTAAATTTTATTACAACCGCAATTAATATACGATGACAAGGAATGGAGTTTGAACGGCTCCCTCTATTCGTTTGATCAATTAAAATTACAGCAGTTCTTCTTCTTCTTTCTCTTCCCGTCTTAGCCGGAGCAATTACAATGCTTCTTACCGACCGAAATTTTAACACCTCTTTCTTCGACCCTGCAGGAGGAGGGGATCCAGTTCTTTACCAACACCTCTTCTGGTTTTTCGGACACCCAGAAGTATACATCCTGATTCTACCTGGTTTTGGTATAATCTCTCATGTAGTAATACACTACTCAGCTAAGAAAGAAACCTTTGGTACATTAGGAATAATTTATGCTATACTAGCAATTGGTGTTCTTGGTTTTATTGTCTGAGCCCATCACATGTTTACAGTAGGTATAGATGTTGACACCCGTG
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Lepetodrilus gordensis
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 42
Specimens with Barcodes: 42
Species With Barcodes: 1
Public Records: 42
Specimens with Barcodes: 42
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Wikipedia
Lepetodrilus gordensis
Lepetodrilus gordensis is a species of small, deep-sea sea snail, a hydrothermal vent limpet, a marine gastropod mollusk in the family Lepetodrilidae.[2]
Contents |
Description
 | This section is empty. You can help by adding to it. (April 2010) |
Distribution
| This section is empty. You can help by adding to it. (April 2010) |
References
- ^ Johnson, Young, Jones, Waren & Vrijenhoek. 2006. Migration, isolation, and speciation of hydrothermal vent limpets (Gastropoda, Lepetodrilidae) across the Blanco transform fault. Biological Bulletin (Woods Hole), 210(2): 140-157
- ^ Lepetodrilus gordensis Johnson, Young, Jones, Waren & Vrijenhoek, 2006. Retrieved through: World Register of Marine Species on 11 April 2010.
Source:
Wikipedia
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
