Physical Description

Type Information

Paratype for Lepetodrilus gordensis Johnson et al., 2001
Catalog Number: USNM 1083160
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Locality: Gorda Ridge, at hydrothermal vent, Oregon, United States, North Pacific Ocean
Depth (m): 2715 to 2715
Vessel: Tiburon ROV
  • Paratype: Johnson, S. B., et al. 2006. Migration, Isolation, and Speciation of Hydrothermal Vent Limpets (Gastropoda; Lepetodrilidae) Across the Blanco Transform Fault. Biol. Bull. 210
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 2198.5 - 2701
  Temperature range (°C): 1.771 - 1.924
  Nitrate (umol/L): 39.961 - 42.195
  Salinity (PPS): 34.596 - 34.634
  Oxygen (ml/l): 1.469 - 1.944
  Phosphate (umol/l): 2.903 - 3.054
  Silicate (umol/l): 175.643 - 176.826

Graphical representation

Depth range (m): 2198.5 - 2701

Temperature range (°C): 1.771 - 1.924

Nitrate (umol/L): 39.961 - 42.195

Salinity (PPS): 34.596 - 34.634

Oxygen (ml/l): 1.469 - 1.944

Phosphate (umol/l): 2.903 - 3.054

Silicate (umol/l): 175.643 - 176.826
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lepetodrilus gordensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 42 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTACTGCACTAAGAATTCTTATTCGAGCTGAACTCGGGCAGCCGGGAGCTCTTTTAGGAGAC---GACCAACTCTATAATGTAATTGTTACTGCTCATGCATTTGTAATAATTTTTTTCTTAGTCATGCCCCTGATAATTGGGGGGTTCGGAAACTGACTAGTGCCCCTAATGCTAGGGGCTCCTGACATAGCTTTCCCTCGGCTTAACAATATAAGCTTCTGGCTTCTTCCCCCTTCACTCAGTCTCCTCTTAACCTCAGCTGCGGTTGAAAGAGGTGCCGGAACAGGATGAACAGTCTATCCTCCTCTAGCTGGCAATCTAGCTCACGCCGGTGGATCAGTTGATTTAACAATTTTCTCTCTCCATTTAGCCGGTGTATCTTCCATTTTAAGTTCTGTAAATTTTATTACAACCGCAATTAATATACGATGACAAGGAATGGAGTTTGAACGGCTCCCTCTATTCGTTTGATCAATTAAAATTACAGCAGTTCTTCTTCTTCTTTCTCTTCCCGTCTTAGCCGGAGCAATTACAATGCTTCTTACCGACCGAAATTTTAACACCTCTTTCTTCGACCCTGCAGGAGGAGGGGATCCAGTTCTTTACCAACACCTCTTCTGGTTTTTCGGACACCCAGAAGTATACATCCTGATTCTACCTGGTTTTGGTATAATCTCTCATGTAGTAATACACTACTCAGCTAAGAAAGAAACCTTTGGTACATTAGGAATAATTTATGCTATACTAGCAATTGGTGTTCTTGGTTTTATTGTCTGAGCCCATCACATGTTTACAGTAGGTATAGATGTTGACACCCGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lepetodrilus gordensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 42
Specimens with Barcodes: 42
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Lepetodrilus gordensis

Lepetodrilus gordensis is a species of small, deep-sea sea snail, a hydrothermal vent limpet, a marine gastropod mollusk in the family Lepetodrilidae.[2]

Contents

Description

Distribution

References

  1. ^ Johnson, Young, Jones, Waren & Vrijenhoek. 2006. Migration, isolation, and speciation of hydrothermal vent limpets (Gastropoda, Lepetodrilidae) across the Blanco transform fault. Biological Bulletin (Woods Hole), 210(2): 140-157
  2. ^ Lepetodrilus gordensis Johnson, Young, Jones, Waren & Vrijenhoek, 2006.  Retrieved through: World Register of Marine Species on 11 April 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!