Physical Description
Type Information
Paratype for Lepetodrilus fucensis McLean, 1988
Catalog Number: USNM 859500
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Hardiman, Malahoff & Feeley
Year Collected: 1984
Locality: Juan De Fuca Ridge, Endeavour Segment, North Pacific Ocean
Microhabitat: Hydrothermal vents
Depth (m): 2208 to 2250
Vessel: Alvin DSR/V
Catalog Number: USNM 859500
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Hardiman, Malahoff & Feeley
Year Collected: 1984
Locality: Juan De Fuca Ridge, Endeavour Segment, North Pacific Ocean
Microhabitat: Hydrothermal vents
Depth (m): 2208 to 2250
Vessel: Alvin DSR/V
- Paratype:
Trusted
Ecology
Habitat
hydrothermal vents and seeps
-
Warén, A. & Bouchet, P. (2001) Gastropoda and Monoplacophora from hydrothermal vents and seeps; new taxa and records. The Veliger, 44, 116–231.
http://www.marinespecies.org/mollusca/aphia.php?p=sourcedetails&id=138366
Trusted
Depth range based on 22 specimens in 1 taxon.
Water temperature and chemistry ranges based on 22 samples.
Environmental ranges
Depth range (m): 1519.5 - 3240
Temperature range (°C): 1.643 - 2.777
Nitrate (umol/L): 34.711 - 44.610
Salinity (PPS): 34.493 - 34.656
Oxygen (ml/l): 0.774 - 3.998
Phosphate (umol/l): 2.419 - 3.172
Silicate (umol/l): 68.288 - 176.826
Graphical representation
Depth range (m): 1519.5 - 3240
Temperature range (°C): 1.643 - 2.777
Nitrate (umol/L): 34.711 - 44.610
Salinity (PPS): 34.493 - 34.656
Oxygen (ml/l): 0.774 - 3.998
Phosphate (umol/l): 2.419 - 3.172
Silicate (umol/l): 68.288 - 176.826
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 22 samples.
Environmental ranges
Depth range (m): 1519.5 - 3240
Temperature range (°C): 1.643 - 2.777
Nitrate (umol/L): 34.711 - 44.610
Salinity (PPS): 34.493 - 34.656
Oxygen (ml/l): 0.774 - 3.998
Phosphate (umol/l): 2.419 - 3.172
Silicate (umol/l): 68.288 - 176.826
Graphical representation
Depth range (m): 1519.5 - 3240
Temperature range (°C): 1.643 - 2.777
Nitrate (umol/L): 34.711 - 44.610
Salinity (PPS): 34.493 - 34.656
Oxygen (ml/l): 0.774 - 3.998
Phosphate (umol/l): 2.419 - 3.172
Silicate (umol/l): 68.288 - 176.826
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Lepetodrilus fucensis
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 22 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 22 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GGTACTGCACTAAGAATTCTTATTCGAGCTGAACTTGGACAACCGGGGGCTCTTTTAGGAGAC---GACCAACTCTATAATGTAATTGTTACTGCCCATGCATTCGTAATAATTTTTTTCCTAGTTATGCCCCTAATAATTGGAGGATTTGGAAACTGATTAGTGCCCCTAATGCTAGGAGCCCCTGATATAGCTTTCCCTCGACTTAACAATATAAGCTTCTGACTTCTTCCCCCGTCACTTAGCCTCCTCTTAACCTCAGCTGCCGTTGAAAGAGGTGCCGGAACAGGTTGAACAGTCTACCCTCCTCTAGCTGGTAATCTAGCCCACGCAGGTGGATCAGTTGATTTAACAATTTTCTCCCTCCATTTAGCTGGTGTGTCTTCCATTTTAAGTTCTGTAAATTTTATTACAACCGCAATTAATATACGATGACAAGGAATAGAATTTGAGCGGCTGCCCCTATTCGTCTGATCGATTAAAATTACAGCAGTGCTTCTTCTTCTTTCTCTTCCCGTTTTAGCCGGAGCAATCACGATGCTTCTTACCGACCGAAATTTTAACACCTCTTTCTTCGACCCTGCAGGAGGAGGAGATCCGGTTCTCTATCAACATCTCTTCTGGTTTTTTGGGCACCCAGAAGTATACATTCTGATTCTTCCTGGTTTTGGTATAATCTCCCATGTAGTAATGCACTATTCAGCTAAAAAAGAAACCTTTGGTACATTAGGAATAATTTATGCTATACTAGCAATTGGTGTTCTCGGCTTCATTGTATGAGCTCATCACATGTTTACAGTAGGTATAGATGTCGACACCCGTG
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Lepetodrilus fucensis
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Specimens with Barcodes: 22
Species With Barcodes: 1
Public Records: 22
Specimens with Barcodes: 22
Species With Barcodes: 1
Trusted
Genomic DNA is available from 3 specimens with morphological vouchers housed at Australian Museum, Sydney and Queensland Museum
Trusted
Wikipedia
Lepetodrilus fucensis
Lepetodrilus fucensis is a species of small, deep-sea sea snail, a hydrothermal vent limpet, a marine gastropod mollusk in the family Lepetodrilidae.[1]
Contents |
Description
The shell grows to a size of 10 mm.
| This section requires expansion. (February 2013) |
Distribution
This species occurs in hydrothermal vents and seeps of the Juan de Fuca Ridge, Northeast Pacific
References
- Warén, A. & Bouchet, P. (2001) Gastropoda and Monoplacophora from hydrothermal vents and seeps; new taxa and records. The Veliger, 44, 116–231
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


