Physical Description

Type Information

Paratype for Lepetodrilus fucensis McLean, 1988
Catalog Number: USNM 859500
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Hardiman, Malahoff & Feeley
Year Collected: 1984
Locality: Juan De Fuca Ridge, Endeavour Segment, North Pacific Ocean
Microhabitat: Hydrothermal vents
Depth (m): 2208 to 2250
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

hydrothermal vents and seeps
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 22 specimens in 1 taxon.
Water temperature and chemistry ranges based on 22 samples.

Environmental ranges
  Depth range (m): 1519.5 - 3240
  Temperature range (°C): 1.643 - 2.777
  Nitrate (umol/L): 34.711 - 44.610
  Salinity (PPS): 34.493 - 34.656
  Oxygen (ml/l): 0.774 - 3.998
  Phosphate (umol/l): 2.419 - 3.172
  Silicate (umol/l): 68.288 - 176.826

Graphical representation

Depth range (m): 1519.5 - 3240

Temperature range (°C): 1.643 - 2.777

Nitrate (umol/L): 34.711 - 44.610

Salinity (PPS): 34.493 - 34.656

Oxygen (ml/l): 0.774 - 3.998

Phosphate (umol/l): 2.419 - 3.172

Silicate (umol/l): 68.288 - 176.826
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lepetodrilus fucensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 22 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTACTGCACTAAGAATTCTTATTCGAGCTGAACTTGGACAACCGGGGGCTCTTTTAGGAGAC---GACCAACTCTATAATGTAATTGTTACTGCCCATGCATTCGTAATAATTTTTTTCCTAGTTATGCCCCTAATAATTGGAGGATTTGGAAACTGATTAGTGCCCCTAATGCTAGGAGCCCCTGATATAGCTTTCCCTCGACTTAACAATATAAGCTTCTGACTTCTTCCCCCGTCACTTAGCCTCCTCTTAACCTCAGCTGCCGTTGAAAGAGGTGCCGGAACAGGTTGAACAGTCTACCCTCCTCTAGCTGGTAATCTAGCCCACGCAGGTGGATCAGTTGATTTAACAATTTTCTCCCTCCATTTAGCTGGTGTGTCTTCCATTTTAAGTTCTGTAAATTTTATTACAACCGCAATTAATATACGATGACAAGGAATAGAATTTGAGCGGCTGCCCCTATTCGTCTGATCGATTAAAATTACAGCAGTGCTTCTTCTTCTTTCTCTTCCCGTTTTAGCCGGAGCAATCACGATGCTTCTTACCGACCGAAATTTTAACACCTCTTTCTTCGACCCTGCAGGAGGAGGAGATCCGGTTCTCTATCAACATCTCTTCTGGTTTTTTGGGCACCCAGAAGTATACATTCTGATTCTTCCTGGTTTTGGTATAATCTCCCATGTAGTAATGCACTATTCAGCTAAAAAAGAAACCTTTGGTACATTAGGAATAATTTATGCTATACTAGCAATTGGTGTTCTCGGCTTCATTGTATGAGCTCATCACATGTTTACAGTAGGTATAGATGTCGACACCCGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lepetodrilus fucensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 3 specimens with morphological vouchers housed at Australian Museum, Sydney and Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Lepetodrilus fucensis

Lepetodrilus fucensis is a species of small, deep-sea sea snail, a hydrothermal vent limpet, a marine gastropod mollusk in the family Lepetodrilidae.[1]

Contents

Description

The shell grows to a size of 10 mm.

Distribution

This species occurs in hydrothermal vents and seeps of the Juan de Fuca Ridge, Northeast Pacific

References

  1. ^ Lepetodrilus fucensis McLean, 1988.  Retrieved through: World Register of Marine Species on 11 April 2010.
  • Warén, A. & Bouchet, P. (2001) Gastropoda and Monoplacophora from hydrothermal vents and seeps; new taxa and records. The Veliger, 44, 116–231
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!