Articles on this page are available in 1 other language: Arabic (18) (learn more)

Overview

Brief Summary

Stauroteuthis syrtensis, also known as the glowing sucker octopod, is a species of small pelagic octopus found at great depths in the north Atlantic Ocean. It is one of a very small number of octopuses to exhibit bioluminescence. Stauroteuthis syrtensis is described as "benthopelagic" -- being found in open water, but near the bottom.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Catherine Sutera

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographic Range

This species has been frequently observed in waters off the continental shelf of eastern North America, but has also been found in locations in the northeastern Atlantic.

Biogeographic Regions: atlantic ocean (Native )

  • Collins, M. 2002. Cirrate octopods from Greenland and Iceland waters. Journal of the Marine Biological Association of the United Kingdom, 82: 1035-1036.
  • Collins, M., C. Henriques. 2000. A revision of the family Stauroteuthidae (Octopoda:Cirrata) with redescriptions of Stauroteuthis syrtensis and S. gilchristi. Journal of the Marine Biological Association of the United Kingdom, 80: 685-697.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Western Atlantic: Nova Scotia to Long Island
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

This species belongs to the cirrate octopods, distinguished by fins used for swimming, an internal shell (to which the fins attach) and cirri, paired filaments or papillae, on each sucker. Like other species in the Stauroteuthidae, S. syrtensis has a u-shaped internal shell, and secondary webbing that connects the arms to the primary web. This allows the arms to move inwards towards the mouth without collapsing the large bell-shaped web of skin that forms around arms. The web covers nearly two thirds of their total length ending at sucker 25, with each arm bearing between 55 to 65 suckers. The average arm length is about 70-85% of its total length with total lengths ranging from 280-500mm.

The body of these animals is soft and gelatinous, and is often heavily damaged in trawls and collections. It is often found hanging in the water with its webbed arms forming a bell shape. There are large glands near the mouth that may produce mucous to trap small prey animals.

Males have sexually dimorphic suckers. The first 8 suckers are barrel shaped, suckers 9 to 22-25 are enlarged and pointed. Suckers 9 to 12 are very closely packed and suckers 13 to 18 are the largest with a diameter of about 6.5 mm. Females have smaller suckers with suckers 1 to 3 as the largest with a diameter of 2.2 mm. Suckers 1 to 4 are very tightly packed, but suckers 5 to 24 are well separated. In both sexes, the suckers diameter decreases dramatically after sucker 25 nearing where the web ends. Both male and females have three kinds of suckers, proximal, mid arm, and distal. This sexual dimorphism in the size and shape of the suckers is unique to the species, and is probably related to sperm transfer or other reproductive activity.

Range length: 280 to 500 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes shaped differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Holotype for Stauroteuthis syrtensis Verrill, 1879
Catalog Number: USNM 382471
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: female;
Preparation: Isopropyl Alcohol
Year Collected: 1879
Locality: Banquereau, 30 Mile E. Of Sable Island, Nova Scotia, Canada, North Atlantic Ocean
Depth (m): 457 to 457
Vessel: Polar Wave R/V
  • Holotype: Verrill, A. 1879. Am. J. Sci. Arts. 18: 468-470.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

bathyal
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Stauroteuthis syrtensis is described as "benthopelagic" -- being found in open water, but near the bottom. and can be found in depths of the ocean ranging from 500-4000m. This large range seems to relate to water temperature. Stauroteuthis syrtensis prefers a temperature of 3.0 - 3.3 degrees Celsius.

Range depth: 250 to 4000 m.

Average depth: 2000 m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: pelagic ; benthic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 28 specimens in 1 taxon.
Water temperature and chemistry ranges based on 26 samples.

Environmental ranges
  Depth range (m): 457 - 3458.5
  Temperature range (°C): 2.617 - 8.658
  Nitrate (umol/L): 16.616 - 20.438
  Salinity (PPS): 34.791 - 35.652
  Oxygen (ml/l): 4.496 - 6.416
  Phosphate (umol/l): 1.092 - 1.305
  Silicate (umol/l): 10.628 - 22.132

Graphical representation

Depth range (m): 457 - 3458.5

Temperature range (°C): 2.617 - 8.658

Nitrate (umol/L): 16.616 - 20.438

Salinity (PPS): 34.791 - 35.652

Oxygen (ml/l): 4.496 - 6.416

Phosphate (umol/l): 1.092 - 1.305

Silicate (umol/l): 10.628 - 22.132
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

No specimens have been seen capturing prey, but the stomach of preserved specimens contained small crustaceans, mostly copepods. The bell shape of the web, along with mucus produced by glands around the mouth, maybe be used to capture zooplankton. The bioluminescence of the suckers is also thought to be used to attract prey, but this has not yet been confirmed.

Animal Foods: aquatic crustaceans; zooplankton

Primary Diet: carnivore (Eats non-insect arthropods); planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Predation

Because little has been witnessed in the wild about this species, its predators have not been observed. When observed, Staurotheuthis syrtensis is normally in a bell posture. When disturbed though, the animal goes into a balloon posture with the arms closed at the tips. In the balloon posture, the fins remain motionless. Staurotheuthis syrtensis has also been seen in a pumpkin posture when threatened which is like the balloon posture, but smaller. When trying to escape, the Staurotheuthis syrtensis will go back in to the bell posture and move its fins vigorously.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Communication in Stauroteuthis syrtensis has not been observed. The species has large eyes, and is likely sensitive to chemicals and touch.

Stauroteuthis syrtensis are unique among other cirrate octopods in that they have modified suckers that are capable of producing blue-green bioluminescence with a maximum wavelength of 470nm. These modified suckers are unlike other suckers because they are not able to attach. Their use is not well understood, but it is suggested that they may be used to attract prey or be used to attract a mate.

Communication Channels: visual ; tactile ; chemical

Other Communication Modes: photic/bioluminescent

Perception Channels: visual ; tactile ; chemical

  • Johnsen, S., E. Balser, E. Fischer, A. Widder. 1999. Bioluminescence in the deep-sea cirrate octopod Stauroteuthis syrtensis Verrill (Mollusca: Cephalopoda). Biological Bulletin, 197(1): 26-39.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

Because juvenile specimens have not been found, little is known about how Stauroteuthis syrtensis develops. However, the large size of the eggs suggests direct development.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The longevity of Stauroteuthis syrtensis is unknown.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Nothing is known about the mating system or mating behavior of this species.

What little is known about reproduction in Stauroteuthis syrtensis has been has been determined by examining preserved specimens.The male genital system consists of testis, vas deferens, needhams sac, accessory gland, and terminal organ. The seminal vesicle is packed with about 100 spermatophores each with a length of 1-2mm.

The female genitalia are unpaired and consist of a single oviduct (with both proximal and distal portions) and an oviducal gland. The majority of the eggs were less than 1mm, but the largest found were in upwards of 11mm. This larger egg size suggests a more developed maturation stage. The ovary contained about 900 eggs. Eggs were also found in the proximal oviduct maybe ready for fertilization.

Breeding interval: Breeding interval unknown.

Breeding season: Breeding season unknown.

Range number of offspring: 900 (high) .

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Because no juvenile specimens have been found, little is known about the parental care of these species.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female)

  • Collins, M. 2002. Cirrate octopods from Greenland and Iceland waters. Journal of the Marine Biological Association of the United Kingdom, 82: 1035-1036.
  • Collins, M., C. Henriques. 2000. A revision of the family Stauroteuthidae (Octopoda:Cirrata) with redescriptions of Stauroteuthis syrtensis and S. gilchristi. Journal of the Marine Biological Association of the United Kingdom, 80: 685-697.
  • Collins, M., R. Young, M. Vecchione. 2008. "Stauroteuthidae Grimpe 1916" (On-line). Tree of Life Web Project. Accessed February 04, 2009 at http://tolweb.org/Stauroteuthis/20092/2008.04.28.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Stauroteuthis syrtensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACATTATATTTTATCTTTGGAATTTGATCTGGTTTATTAGGAACGTCACTAAGCCTAATAATCCGTACGGAATTAGGACAACCAGGTTCTCTATTAAATGAT---GACCAATTATATAATGTAATTGTTACTGCCCATGCATTTGTAATAATTTTTTTTTTAGTAATACCGGTAATAATTGGTGGTTTTGGTAACTGATTAGTTCCTTTAATATTAGGAGCCCCAGACATAGCCTTCCCACGAATAAACAACATAAGATTTTGATTACTTCCGCCTTCCCTCACCCTTCTACTAACTTCAGCCGCAGTAGAAAGTGGCGCAGGAACAGGATGAACTGTATACCCCCCATTATCAAGAAATATAACACATACTGGTCCCTCAGTTGACCTTGCTATCTTCTCCCTTCATCTCGCAGGTGTATCCTCAATTCTAGGGGCAATTAATTTTATCACAACAATTATCAACATACGATGAGAAGGGATACAAATAGAACGCCTACCTCTATTCGTTTGATCCTTACTAATTACCGCTATTCTCCTACTATTATCCCTTCCTGTCCTAGCAGGAGCAATTACTATACTCTTAACAGACCGAAACTTCAATACTACATTTTTTGATCCTAGGGGTGGAGGTGACCCAATTTTATACCAACATCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Stauroteuthis syrtensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The population size of this species is unknown. It has not been evaluated by the IUCN, and is not listed in CITES or under the U.S. Endangered Species Act.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Stauroteuthis syrtensis on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

S. syrtensis does not appear to have any positive importance for humans at this time.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Stauroteuthis syrtensis

Stauroteuthis syrtensis, also known as the glowing sucker octopus, is a species of small pelagic octopus found at great depths in the north Atlantic Ocean. It is one of a very small number of octopuses to exhibit bioluminescence.[2]

Taxonomy[edit]

The cirrate octopuses are deep sea species that have been relatively little studied. Some have been described on the basis of a single, poorly preserved specimen, and this makes deducing their phylogenetic relationships difficult.[3] Some authorities adopt the traditional view that the genus Stauroteuthis is part of the family Stauroteuthidae. The World Register of Marine Species, however, considers that it should be placed in the family Cirroteuthidae, basing this decision on ribosomal DNA and other evidence, and that Stauroteuthidae is a synonym of this family.[1][4][5]

Description[edit]

The mantle length of Stauroteuthis syrtensis is about 5 to 10 cm (2 to 4 in) and its width about 4 cm (1.6 in). The fins are some 4 to 6 cm (1.6 to 2.4 in) in width. The eight arms are of unequal length, the longest extending to about 35 cm (14 in). These are joined for two-thirds of their length by two webs, a dorsal complete membrane and a ventral partial one, giving the animal an umbrella-like shape. A total of about 60 adhesive suckers are found on each arm. Twenty-five of these are larger and extend to the edge of the web. In the male, the first eight suckers are reduced and the rest large and conical, but in the female, they are of an even size. Between suckers 8 to 25 there are conspicuous cirri. These are elongate, fleshy tendrils borne on the sides of the oral surface of the arms, the longest being at sucker 20. A further 30 to 40 smaller, closely packed suckers are on the arm extensions and tips.[6] The general texture is gelatinous and the animal is reddish-brown and translucent, with the internal organs being visible through the skin. A vestigial, U-shaped, internal shell supports the fins, the only other hard part of the animal being the two-part beak.[7]

Distribution[edit]

S. syrtensis is found in the North Atlantic at an extreme depth range of 500 to 4,000 m (1,600 to 13,000 ft). It is most frequently found a few hundred metres from the bottom of the ocean at depths between 1,500 and 2,500 m (4,900 and 8,200 ft). It seems to be fairly common off the edge of the continental shelf on the eastern coast of the United States, and has also been observed at similar depths off the British Isles.[6]

Bioluminescence[edit]

Stauroteuthis is one of only two genera of octopuses to exhibit bioluminescence.[2] S. syrtensis emits a blue-green light from about 40 modified suckers known as photophores situated in a single row between the pairs of cirri on the underside of each arm. The distance between these decreases towards the ends of the arms with the light becoming fainter. The animal does not emit light continuously, but can do so for a period of five minutes after suitable stimulation.[2] Some of the photophores emit a continuous stream of faint light, while others are much brighter and switch on and off in a cyclical pattern, producing a twinkling effect.[2] The function of the bioluminescence is believed to be for defence, being used by the animal to scare off predators, and also as a lure for the planktonic crustaceans that form its main diet.[2] The light may also be used for sexual signalling, but this is considered to be an unlikely function, as the light is deployed by both sexes and by immature, as well as mature, individuals.[2]

References[edit]

  1. ^ a b Pierre Bouchet (2011). "Stauroteuthis syrtensis Verrill, 1879". World Register of Marine Species. Retrieved 2011-10-06. 
  2. ^ a b c d e f Johnsen, S.; E.J. Balser; E.C. Fisher; E.A. Widder (1999). "Bioluminescence in the deep-sea cirrate octopod Stauroteuthis syrtensis Verrill (Mollusca: Cephalopoda)". The Biological Bulletin 197 (1): 26–39. doi:10.2307/1542994. 
  3. ^ Taxonomy of the deep-sea octopods Ocean Research Laboratory. Retrieved 2011-10-04.
  4. ^ Piertney S.B., Hudelot C., Hochberg F.G. & Collins M.A. (2003). "Phylogenetic relationships among cirrate octopods (Mollusca: Cephalopoda) resolved using mitochondrial 16S ribosomal DNA sequences". Molecular Phylogenetics and Evolution 27 (2): 348–353. doi:10.1016/S1055-7903(02)00420-7. PMID 12695097. 
  5. ^ Collins M.A. & Villanueva R. (2006). "Taxonomy, ecology and behaviour of the cirrate octopods". Oceanography and Marine Biology: An Annual Review 44: 277–322. doi:10.1201/9781420006391.ch6. 
  6. ^ a b Stauroteuthis syrtensis - Verrill 1879 The Tree of Life Web Project. Retrieved 2011-10-04.
  7. ^ Stauroteuthis Encyclopedia of Life. Retrieved 2011-10-04.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!